Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

[Ultimate Charizard]

Here we go, lets see if this can get off the ground.

Name: Keruga'Vyorn of the Feran Clan (Gav for Short)
Race: Feran Demon
Age: 20
Looks: Totally Human in appearance it is only obvious when he shifts into his demon form becoming feline in appearance. Elongated Fangs, catlike eyes and large black furred ears on top of his head. A long black tail accompanies the patches of black fur that appears but not toally covers his body. Wears a Black T-shirt, Blue jeans and Black Fingerless Gloves. His transformations dont bother the clothes too much, except for the tail. Sometimes wears a black long leather coat.
Abilities: Heightnened Senses, Speed, agility, Balance and some strength, he is a virtually upgraded Vampire in most abilities but strength.
Personailty: Likes a joke, is a young hunter and therefore can be a little cocky. Taking too much pride in his abilities. A fan of human movies he likes to quote films and attempt moves from martial arts films as if a fight is a game. Very loyal and protective to those he calls friend.
History: Born and trained like every other young Feran in the martial arts of the Clan. As he entered his teens he became rebellious. One of the top of his class he ventured out alone. Still keeping ties with the clan but living as a human. Becoming accustomed to the Human culture and its customs. Eventually learning of the human martial arts he learned and mixed the Demon skills with the Human styles creating his own hybrid fighting style. Has become a skilled Hunter at night while living a relatively normal human life during the day.
Allegiance: Demon Clans
Other: Fights with a Katana sword and a handgun (similar to the on in blade). Works in the local hospital as a porter during the day. He sees it as a good way to get leads on 'suspicious injuries'

It begins.

Keruga'Vyorn (Gav)
-----------------

I sighed as I closed my locker. My shift had just ended and I headed to the shower throwing off the stained medical smock. Working with the general public was a fun enough job but Sundays were always the worst. Dealing with those that had gotten a little too enthusiastic with the alcohol and other substances. One young man had come in reeking of a fine mix of alcohol, urine and vomit. To my colleagues it was simply a bad smell. With my sense of smell I could pick out every detail, hell I could’ve probably tracked the scent and followed this young drunk's exact route from the night before. It was a horrendous stink and I almost wished I had the inferior senses of my human friends. As I had helped him from reception to one of the examination rooms he had found it a good time to once again empty his stomach and the resulting mess was only the beginning of my day. Now it was just after 3pm as I washed away the remaining traces of the odour.
Drying off and returning to my locker I pulled out my clothes and got changed. I thought I heard a scratching sound but it was so faint I paid no attention to it. The soft giggling sound I heard did catch my attention however and I looked around. There was a scent in the air. Flowers....at least something close to it and the giggling got louder. Suddenly a noise above me and I looked up to see the ventilation shaft cover swinging and a soft feline face smiling down at me.
"Sakea?" I asked puzzled. "What the hell are you doing here?” Sakea'Sagran, another member of my clan, and my best friend slid slowly from the vent and landed on her feet in front of me. "How ya doin" she asked giggling again. "You shouldn’t be here" I said, scolding her even though she was slightly older than me. "Oh sorry" she said as she looked around. She seemed to concentrate and her feline features regressed into a perfect human form.” I forgot, been a while since ive been in the city" She raised a hand to brush her long red hair from her eyes and smiled again. "I don’t mean that" I almost shouted. "Don’t you know this is the men’s room, no females allowed!"
Her grin grew wider "I know, ive been waiting for you for a while but I didn’t know where to look. I figured you’d come in here sooner or later" She paused and seemed to look into the distance. "You know, human males are really funny to watch, I mean for one thing...." I cut in fast changing her line of thought. "Why are you here, it’s a pretty long trip from the clan". She pouted and looked hurt "What sort of greeting is that for your oldest friend?" she asked. I smiled as I started to calm down and I caught that scent again....it was coming from Sakea. "Perfume?" I asked and flashed my cheesiest grin as I pulled on my shirt and closed my locker. "Since when did you decide to join in with the human culture?” She punched my arm playfully. "I just thought id try a few things" she smiled as she sat on the bench beside me. "Taking after my inspiration" I looked at her slowly and pointed to myself? She nodded slowly "A number of the younger Feran have been talking about you lately, 'The wanderer' living amongst the humans. Being your best friend has given me a great reputation. Besides I missed you" I tried to tie my laces as she hugged me around the neck. I smiled and grabbed my bag. "You eaten yet?" I asked her. She shook her head "I haven’t had chance to hunt yet" I laughed; I had almost forgotten the old ways. "Don’t worry the advantage of having a job is you don’t need to hunt. You’ll have to head out the way you came, wont look too good a good looking girl like yourself coming out of here with me. Meet me outside the main entrance in about five minutes ok" She blushed at the complement but it faded as her features grew feline again. She span and leapt nimbly up into the Vent. "See you in five" she called back as she vanished into the dark vent. I jumped up and playfully batted the tip of her tail that hadn’t disappeared. Closing the vent behind her I gathered up my things and made my way to clock off before heading out.

As I stepped out into the fresh air I saw Sakea leaning back against the wall. She had changed back to her human form once more. I noticed a couple of the junior med students watching us. 'Checking her out' I believe the expression went. A smug smile was on her face. She wasn’t looking but she knew she was getting attention. "Not half bad for humans" she teased, keeping her voice low so only I could hear. "But they’d probably scream and run if they knew what I really was" She laughed to herself and I looked over at the young men. "Actually knowing those guys that would only get them more interested" I added a small laugh of my own as she turned and began to walk towards the street. "Well it makes no difference, I don’t go for guys that aren’t even my species" She seemed to strut out onto the sidewalk, her stride full of confidence. We walked to a small restaurant. I knew the place well as it was one of my favourite places to dine. It was mainly a human diner but if you had 'membership' there was a reserved menu for the less common customer.
We went through into the back room and noticed a number of other demon breeds. Of course anyone simply looking through the door into the back wouldn’t know any different but a nose knows. We sat and ordered. Occasionally I would try a human dish but usually it was the demon cuisine. You know the taste of home. They had a Rat Stew here just like mom used to make before id left for the City. Today I had decided on a human meal, couldn’t hurt to show off my adaptation to human food in front of my old friend. I ordered a gammon steak; fair enough it was a nice thick slab of meat but the accompanying vegetables, potatoes, egg and even pineapple rings that came with it wasn’t something id usually go for. Sakea had watched as they brought my order out. She took an inquisitive sniff and licked her lips at the steak but her nose wrinkled up towards the rest of the meal. She had opted for a more familiar Feran dish. It was basically a mix of all the best meats in a thick Gravy. This also hinted at how much training Sakea must do. She had always been a fan of the 'one Feran Feast' yet her body, even in human form was lean and muscular yet not too thin or too butch. A female hunter could use her looks to draw in any stupid vampires unfamiliar with her scent and Sakea was the sort of female you couldn’t resist even if you did know she would kill you. After the meal we headed back to my apartment. It was getting quite late in the day now and the sun would soon be setting. I had things to prepare. "I unlocked the door and Sakea stepped in. "Your going soft" she simply said.”Living in a luxury home, buying food rather than hunting it" She looked me square in the face, her eyes burning into me. I looked around. Luxury wouldn’t have been a word id use to describe this place but compared to the cave and forest background of the clan I guess it was pretty nice.” So you think ive lost my edge?" I said a small growl present in my voice. "I do" she said in reply "Living among humans has made you weak" she matched my growl with one of her own. I grinned to myself and looked at her. I had missed this. Sakea regularly used to challenge me, testing my abilities keeping me on my toes as we were growing up. I smiled brightly. "I really have missed you" I said, the growl completely gone from my voice. She raised one eyebrow and shifted her feet. At that moment my hand flashed out, grabbed her wrist and twisted. As I turned she was flipped over onto the couch. "Looks like im not the one who's gone soft" I said with a wink. She growled and threw a cushion at me.
"How long you planning on staying?" I called as I headed to my bedroom to prepare my weapons. "Well that’s the thing" she began "Im thinking of setting up like you" her head peeked around at the doorway. She was back in her Demon form. She had always preferred to be herself than disguised. "If its ok id like to stay here while I can get a job and a home of my own"
I held back a laugh. It was well known that Sakea had never been too bothered about the human life but it seemed something had changed. "So that explains the perfume" I laughed out loud, "sure you can stay here as long as you want, there’s another bedroom there behind you, its yours" She ran in and grabbed me in a hug. In our different forms her strength advantage was overwhelming and I found it hard to breath. She laughed and squeezed again just to add to the pressure then thankfully she loosened her grip. "I knew I could count on you" she beamed and seemed to bounce back out of the room.
"Tell you what, since it seems were gonna be roomies you may as well help me out. It’s been along time since ive had company when out hunting and I could show you the city, learn your way around.....well start tonight"

[Outlaw JT]

Name: Ashram Marduk (he is called Hammurabi by the eldest vampires)
Race: vampire
Age: His true age is unknown but he is the only known ancient left among the vampires.
Looks: 6'7", long jet black hair, short triangular goatee, very broad shoulders, wears a black hoodless cloak, black pants, white ruffle shirt under a tight red vest. His sword remains hidden under his cloak. It is made of an unknown black metal and has the image of a long forgotten god etched on its blade in silver
Abilities: His strength and speed are unrivaled in the known demon world. His other senses and physical abilities are on par with the strongest of demons or vampires.
Personailty: Calculating, aggressive, intelligent, confident, ruthless.
History: His true origans are unknown but he can be linked back as far as the Babylonian empire. He came to Pernicious very shortly after it was first built. At first he was the lead general of the previous vampire ruler. Around 1860 though the previous ruler grew weak for unknown reasons. It was at that time that he became the ruler of the vampire nation. He took it upon himself to kill the former ruler to put him out of his misery. Since then he has slowly taken a more aggressive approach to his rule. He thoroughly believes vampires to be superior to all the other demon breeds and most especially to humans.
Allegiance: He is the vampire ruler.
Other: He is the oldest known vampire left but he assures others that he is certainly not the original.


Ashram Marduk {Hammurabi to the eldest of vampires(eldest being older than 2000)}
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

The last rays of sunlight crept slowly across the floor of his main chambers. Most vampires would be afraid to have the daylight reflected into their domain but not him. He embraced its presence. He counted the hours buy it.
When Ashram took over the first thing he did was have a series of mirrors rigged all the way from the surface so that the suns rays would reach a singular strip of his main chambers. His reasoning was so he could measure the length of the day so he could better prepare for the following night. Really though, he was just fascinated by the sunlight and the fear it instilled in his brethren. The closer he was to fear, the easier it was to overcome. The presence of sunlight also served as a wonderful tool of intimidation when dealing with subordinates.
Eventually he tired of his sungazing though, and he once again began reading the reports that had been brought before him earlier. Such mindless beuracratic nonsense but he could not foresake the day to day tolls of rulership.
"Tels'Teth, I believe another meeting with the mayor and police chief are in order. They have started becoming a little too efficient in the red sectors of Pernicious. It does not serve anyone well for one of their uninitiated patrolmen to stumble on one of the feeding clubs. Also, the medical examiner out of Pernicious General Hospital has begun raising too many questions. See that he is eliminated quietly and replaced with a suitable doctor. One more easily controlled. On a side note, you need to preper a speech about feeding zones and prey types and caution. We can't just have every vampire leaving everyone and anyone they decide to snack on anywhere they please. Anyone with a higher social standing than homeless simply must be disposed of properly," Ashram said plainly. He had no enthusiasm left for boring matters of state. His interests lie elsewhere at the moment.
"Will there be anything else Lord Marduk?" Tels'Teth replied tentatively.
"One more thing, yes. Have my hunters found anything out yet about the........the special prey?" Ashram replied carefully.
"No, sir. They are still searching for whatever it is you sent them after. As I understand it they are following some rumors among the lower demon communities but nothing major so far," Tels'Teth hesitantly answered back.
"Very well then. Let the generals know that we will not hold assembly tonight. I have not roamed the streets of Pernicious for quite some time. I think I shall have a stroll this evening. Those demon hunters need to be reminded of the error of their ways!" Ashram said with cold precision.
As Tels'Teth left Ashram got up from his seat of power and walked over to the last of the fading lights of day. He paused at the very edge, a mere inch from its dying warmth. He stretched his open palm out towards it but stopped a fraction short of its receding boundary.
"Soon," he whispered to himself. "Very soon now."


OOC: just so you know the medical examiner mentioned is the one that works in the same hospital as Asi and U_C's characters.

[Kuro Espeon]

Name: Roku Veradim
Race: Dragon demon
Age: her actual age is around 1500 (her clan has incredible longevity...) but physically she looks to be in her early 20's.
Looks: About 6'2 in height and very lean. Long jet-black hair with two strands of blood red in the front and mysterous red eyes that seem to glow. Her skin is slightly pale but still has a little bit of color. Has a set of sharp fangs and talons (or claws, whatever...) and long, pointed ears. She normally wears a black, baggy kimono top that is fringed with red and gold and knee-length oriental-style pants of matching color. On the back of her kimono top is the Japanese symbol for "Shadow Dragon." (Also has a dragon form...will explain this later) When she chooses she can bring out her large pair of red dragon wings.
Abilities: Very agile and fast and has very keen senses, making it easy for her to track her enemies or know when someone is about to attack her. Has some slight psychic and telepathic abilities as well and can also transform into a large black, ruby-eyed dragon at will. (Doesn't do it TOO often cause it wastes her energy)
Personailty: Very crafty and mysterious. Her sarcastic and cynical attitude tends to confuse some people as to how she really feels and where her true loyalties lie, but she is always true to her word and will never betray the trust of her commrades.
History: One of the highest ranking warriors of the Kage-Ryu Dragon Clan, and it is rumored that she is the heir of the ancient Dragon Lord Ryushin who once reigned over all of the dragon clans. But since that time the Dragon Clan has broken up into several small factions and live in various places across the globe. Roku's father went missing after a battle with a group of vampiric warriors (wether or not he is actually dead is a mystery...) and she therefore has a personal vendetta against all or most vampires. She came to the city of Pernicious in order to search for clues about her father and to help quell the vampire uprising.
Allegiance: Demons
Other: ermm...I'll get back to you on this one....too tired...

Roku Veradim:
~~~~~~~~~
The darkness...ah, yes! The darkness was a welcome sight to me! When the daylight faded and the sun ducked below the neverending horizon, the creatures of the night would come out to play. It was at this time that I could shed my human mask and take back my true form...my demon form. And I definetly felt more free and empowered when i was not donning my human shell.
"Ahh! That's better!" I sighed as I changed back into my demon form. I stretched out my wide red dragon wings and beat them twice, stretching them out after the long day of them being concealed.
As I stared out into the darkening streets of Pernicious, I could sense that all, or at least most, of the humans were gone, and were now hiding in the safe refuge of their homes. It was just as well...it was not them that I was after....
I looked around and tried to pick up the scent of any vampires that might be nearby. I was disappointed when I couldn't find one. But they would come...sooner or later. They couldn't hide from me...not for long anyway. I was determined to rid this city of each and every vampiric evil. And then, once my revenge against this race had been achieved, I would be able to find my father...

[Bulbasaur4]

Name: Dhaeraow (Means, "traitor" and that is what most of the population upon the demon side calls her. But her real name is "Perya Morwen" Which translates to, " Half Daughter of the Dark" )
Race: Half human, half demon (pure shadow demon)
Age: Unknown - her appearance is mid-twenties however.
Looks: http://www.megatokyo.com/extra/broken_miho-full.jpg
Just like that (above!) She even has the strange, metallic looking wings but they can fold up so nicely that no one sees them. She looks like that but wears different clothing. She wears a tight, black tank top which is strapless, and below that she wears tight black, almost leather-looking pants but they are not leather and are very flexible. She wears boots like in teh picture, except they are light weight and not as clompy looking. She wears black, finger-less gloves as well, and around her neck is a silver chain with a strange symbol pendant upon it. On the back of her shoulder blade is another symbol- a tattoo in black, but she herself did not put that on her. She was born with it and has yet to figure out it's meaning. She also usually wears a black cloak which ties around her neck upon her back, so it covers her pressed wings (but they are hidden underneath her tank and she doesn't use them much.)
Abilities: She has a strange ability to be able to have an uncanny prediction or 'feel' for things- sort of like being lucky and being able to read auras. She's very swift and agile and has natural simple fighting ability as far as movements go. She can also summon her shadow side to blend into the shadows for only a limited amount of time.
Personailty: She's very quiet, doesn't like to talk much. Rather is shy and doesn't like to hang around other people... or creatures. She's been outcasted all her life because of what she was born as, and thus she has learned to stay away from others. You'll find out more... but deep inside, she's caring and innocent. The life just tainted her.
History: She was born to a human when a demon, a pure shadow demon (dun see many of those now adays..) was near death by an attack. In her last fatal attempt to keep her race alive, she sent part of her own 'parts' if you may, into the female human who just happen to be near the area of the demon's death site. THis impregnented her, and when the human mother gave birth she was utterly petrified (also confused in how she was pregnent). Out of her disgust, with out telling anyone, she threw the baby into a trash can in hopes of killing it (suffocation) and not having to worry about it.
But the demon side in Perya allowed her to live... and after a petrifying wail, a passer-by human found her. He was a nice man and actually own a dojo where he taught many forms of Chinese and Japanese fighting techniques. He had money and so he didn't want to make the baby go through the pain of adoption... so he simply took her in. After many years, she grew up to about the age of what could be considered a mid-teen. It was then however, that the demon population learned of her spawn- and being a half breed is very bad and looked down upon. So the demons came and attempted to kill her and the one who raised her - but they only succeeded in killing the man. Perya however managed to cloak herself, and the demons left. She was devastated... and vowed to never be harbored by anyone agian. The rest of her life is unknown and a blur... but she lived and trained herself in the streets the rest of her life (till now) She's known slightly through the human population, and most demons have had wind of her- but none have caught her yet.

Allegiance: Indifferent
Other:




Dhaeraow (Perya Morwen) - F - Demon/Human
"*8*"*8*"*8*"



Why is it that when the dawn fall and the night rises, I never can get any time to myself? Why must I always be the prey... constantly chased by either my halves or the one who hates both?

I nimbly jerked to my right, dashing away from the night air of the street lamps down the dark, wet and hardly-used street. Turning right into an alleyway, I dashed through it. My persuer followed... and I could hear is light, airy footsteps following mine. I knew the city well... and I would never be caught going into a deadend... but my persuer seemed to be extremely skillful in the art of tracking and taking down. Never before had I encountered a demon or vampire which persued me so skillfully... usually I could lose them easily. Occasionaly I battled and disabled them, but this one I sensed could bring some harm... and I wasn't into the mood tonight.

But he was.

My long, dark violet hair rippled in the wind as I scanned the dark alleyway ahead of me... many shadows. I was beginning to feel a bit faint from running, and I knew that going on like this was not going to shrug this guy off. He was a vampire... he reeked of teh stench of one. I never had much against vampires- well, I mean I never had much against them which led to more than demons or humans. all three species persued me. The humans and demons persued me because I was the symbol of both of them combined- some thing that will never and should never be crossed. Humans hated the idea of them intermixing with demons, and to demons it was a sign of weakness. To vampires? Well, they hated demons and humans... so their noses sensing my blood tainted with both probably made me a valuable victory or slaughter.

Why is this one so intently upon me? I thought... usually most gave up by now. He must really enjoy the chase.. I narrowed my eyes, and quickly entered the darkest, shadowy part of the alleyway. My green, startling cat-green/yellow like eyes instantly began to glow and stand out eeriely like a haunting light. As soon as my body became emerged in the darkness, it began to grow almost transparent- blending into the surroundings of the darkness. My eyes instantly stopped glowing, and matched my body with the dark-like quality. I quickly stopped running and pressed my back hard against the shadowy alley wall. Gazing at my persuer as he came at me... I slowed my breathing so that it was not detectable. Standing there I consentrated.... a skill such as shadow cloaking was some thing anyone could not do for very long.

My persuer also slowed down, and I saw the distinctions upon him instantly. His face was pale... common, and his nose was rather long and pointed which I found common amongst most vampires. His eyes gazed about with their dark, black-pitted pupils as he scanned about him. The alleyway was dark, but I knew he wasn't dampered by the darkness... but still, to see a shadow in a shadow was merely impossible- I ionly hoped he thought I kept moving along.

His light, almost blonde, long hair rippled in his movements, as he stood there... walking slowly, and then stopping only a few feet past me. My head was getting dizzy... and a burning sensation was filling my soul points- my wrists, behind my knees and my neck along with my head. My fingers began to twitch, as he stood there.... and never moved. He wasn't being fooled...

I knew if I stayed like this... my body would only be weakened, and easier to tackle when my body could no longer hold this state. I had to make a run for it...
I with drew a breath, and then released my state of shadow quickly. It made no noise or light this time, and I dashed out behind him but the vampire noticed instantly. Whirling around, he with drew a gun and aimed it straight at me. I had little time to react... as he made a fire which was aimed at my leg. I was ready, and whirling around to face him I quickly leapt into the air.

Aiming my booted foot at him, my shoe came in contact with his gun right after he fired and missed my blurred body. The gun whcih was in his hand riquocheted out of his grip, and landed many feet away. I landed in front of him, and in no time he unsheathed yet another weapon- this time a nice, long jeweled sword made out of some metal. I crouched upon the ground, and all of this occuring in seconds he swung at my legs. I flipped backwards, and he kept swinging. I had to keep flipping, until after many swings he grazed my boot, cutting off the front and slicing deeping into my foot. I winced as I took staggering steps backwards, my foot instantly flushed with warm, red liquid swirled with a mixture of strangely violet flecks. But this vampire came at me again... aiming at my legs.

Why is he aiming at my legs? It's like he is trying to disable me. But why? I disable to get away... if he disables me, what for? Why not rather kill me?
It was an action that confused me... but rather then dwell upon the thought, I withdrew my own weapon. Instantly a silver sword unshealthed into the air, and gleamed in the darkness with some uncanny glow. It was made out of pure silver... and encarved into it were many signs of the demonic language- but they were so ancient, even I did not know what they said. Still, it was a loyal and good weapon... and as the vampire thrusted his weight upon me with his sword, I blocked the blow and a clash of metal echoed through the air. I held to him, but he was far more powerful than I was. He pushed me backwards, and I had to quicky leap into the air to keep from falling. Regathering myself, I glared at him as he came at me yet again...

I couldn't run away from this one, and with his ongoing of massive offensive attacks of power... it was going to be one hard battle to win.
Here we go again..
I thought, as he charged at me and I braced for impact, blood oozing from my now numb foot.



(^^ Hope that leaves room.)

[Drusilla]

Name: Drusilla
Race: Vampire
Age: little over 100...
Looks: Click the link in my sig....
Abilities: Night vision, and she's excellant at reading Tarot
Personailty: She loves death and destruction. Unless there's something in it for her, she probably won't do it. For example, ask her to do a favor for you... she'll ask what she'll be paid. Reply any sum of money, and she'll probably give you ten seconds to get away before she starts chasing you. Tell her she'll be able to kill a couple people, she'll think about it. Tell her she'll be able to kill as many as she wants, and she's in!
History: Born a killer. She murdered her familly when she was young, and was left to the streets. She began to hang at the local vampire haunts, and when she was seventeen, they changed her. Ever since, she's been one of the city's finest mercenaries.
Allegiance: She works with who ever offers her the much, but right now the Vamp ruler
Other: Drives a black 2003 Firebird Trans AM, and rarely trusts anyone.

post in the morning... i'm lazy

[Ultimate Charizard]

Keruga'Vyorn
-------------------

The night was cool, a fresh breeze blew across the rooftops. Myseld and Sakea did virtually the same thing, leaping from one roof to another. Both in our demon forms we hd picked up the scent of a Vampire and were following it. Originally i had been hoping to run into Fal'ghi the elderly Shakou demon, "one of the best around till he decided to teach me everything he knew" i smiled to myself. He had been the first i met when i arrived in this city and had taught me well on how to avoid the eyes of the humans. Lessons Sakea should also know. There was another scent mixed with the vampires but it was hard to figure out what it was. There was a hint of fear in the scent, obviously it was the Vampire's chosen prey, and it knew it.

We approached the source of the scent. An alleyway behind a store, closed for the night. Sakea stalked into the darkened alley and i leapt to the low roof. Slowly creeping ahead. As we approached the scene there was another creature locked in combat with the Vampire. The fight was not going well for the Vampire's prey.
She stumbled and i noticed her foot was injured. The vampire kicked her hard in the chest and she slammed against a wall. In one movement i flipped down into the alley and drew my own sword. "Back off Vampire" i warned with a growl. A sound behind it made him turn and Sakea was stood, curved daggers in each hand. I had not seen those in a while. The Crescent Moon's as she called them, were swift, silent and deadly weapons. The vamp turned again and smiled baring its fangs.
I bared my own fangs and readied myself "Lets dance"

[Ginger Cat]

Eh, hope this is semi-passable...

Name: Farson Marrinor
Race: Vampire
Age: 42 (Looks to be twenty… at that age, he was changed)
Looks: 6’3”, with a lanky yet strangely dignified figure. Hair is black with a deep brown tinge, semi-long, semi-wavy. Eyes are a piercing steel gray. Skin is pale, white even. Has a scar passing from the top of his nose on the right side to below his right eye. Wears black pants that are almost jeans… The material is fairly stiff, but not any sort of denim. Shirt is deep gray, --a “dressy” type of shirt that buttons/unbuttons. Over this, he wears a longish black suit jacket, usually unbuttoned, or only partially buttoned. In this manner, he appears both casual and formal.
Abilities: The typical vampire assets… Increased ability of speed, of hearing, of sensing in general. His senses together allow him to perceive almost anyone from quite a long way off, and his speed allows him to move swiftly to defend or attack. Also quite skilled with blending into shadows and staying out of the eyes of those who pass.
Personality: Solitary and somewhat distant from most. He searches the world to his own ends, for the most part, and believes that whatever happens has happened, and there’s not a terrible amount of use in worrying about it.
History: He was bitten at the age of twenty, and has since been in evasion of most forms of life. He enjoys the vampiric lifestyle, but takes it as a loner and likes not to be in the large groups.
Allegiance: Freelance
Other: La la la…

Farson Marrinor
-----------------------------------------

“Bloody humans,” I muttered, looking down at the street from the ledge I had reclined on.

Pausing for a moment, I considered what I’d just said, then laugh shortly, with only a small amount of humor. Bloody humans indeed… That was why they were so very popular with vampires. Bloody.

I needed blood. I hadn’t had any since the previous night, and to go without blood for very long was to ask for death. Sometimes the idea was a pain. I didn’t cringe when it came to killing; murder has never really fazed me, and it certainly didn’t pain me after I became a vampire. The death of a human wasn’t terrible. Mortal life, after all, never lasts very long. What did it matter to take the life? There was nothing for them to loo forward to.

Sometimes I wondered what the point of being a vampire was. What was the point of immortal life if it was as pointless as mortal? This sometimes seemed true, sometimes didn’t. After all, being a vampire was different from being a human. Much was made easier, much was enhanced. Life could be what I wanted it to be. I was my own master.

Perhaps not entirely correct. My Master was technically the one who had created me, but he had long since passed on. There had been no lesson learned from him; he had changed me and continued onward, leaving me to fend for myself. Because of this I had become what some vampires had called “improper”. I wasn’t human, but I didn’t quite behave as many vampires.

Part of being a vampire--perhaps a large part--seemed to revolve around the mind and what it believes. An obvious point here was that I had never hated the sunlight. I certainly didn’t care for it, but I strayed not if I was out in it. Nor had I ever slept in a coffin; it seemed entirely unnecessary.

There was much that I didn’t know, but no one had been able to tell me. Perhaps I was well enough off without instruction. After all, I’d been a vampire for twenty-two years, and there I still was. Even so, there were things I would have liked to have known.

Much of what I wished to know revolved around the origin of vampires, as well as the rumors that I had heard from others of my kind… When they had been unaware of my presence. There were rumors that the vampire population was growing, that they wanted to wipe out all of the humans and demons. There were variations on the tales, but the basic idea was always the same idea of mass destruction.

I couldn’t understand exactly why they’d do it. Apparently, the vampire I met couldn’t understand why I was not in support of it. Not all of them, perhaps, but most had obviously snubbed the humans and the demons. For the life--sub-life, pseudolife, death?--of me, I couldn’t understand this. Nearly all of them had, after all, been humans previously. Perhaps they all had; perhaps there was only one who had not.

“Bloody vampires,” I mused, my eyes trailing over the sidewalk, catching vaguely the thoughts of those below, not paying much attention, only running over the mental voices subconsciously.

Every species was just as f***ed up as the next, it seemed. Ah well. I personally enjoyed being a vampire in some way; the image was appealing to my mind, perhaps. There were points that could be bothersome, but mostly it was lovely in its own way. The sensations that could be felt alone made everything worthwhile.

Looking into the deep sky, I stretched, then stood. It was time for me to find some sort of blood for the night. While I was searching, I could relish the night as I always did, could listen to the thoughts of others, could watch the shapes in the darkness. So alluring…

Leaping from the ledge to the sidewalk several stories below, I landed among the crowd, though they did not see. If anything, they only felt the presence of another who perhaps had quickened speed to suddenly appear from the crowd behind them. Walking swiftly, I soon passed by these humans, cutting through the crowd easily.

The night and everything about it was beautiful. Who could prefer the daylight? I could watch it, I could sit through it, but why bother? The night was more beautiful. The day was a wasteland, a horrid wasteland filled with bright hatred.

The night was alluring. So very, very alluring.

-------------------

[DarkTemplarZ]

Name: Ty'Lan Qui-Shi(Tie-Lan Kwi-Shee)
Race: Phoenix Demon
Age: about 2000-2100(see abilities)
Looks: Tall, around 7'8, rather thin looking. His eyes are like birds eyes-round and dark, with black stripes and very small brow ridges, and his nose is hooked, like a beak. His face below his nose looks almost identical to a human, except his lips are thinner and quite hard. His skin is pale, but with a heavy red tint, and he has long solid red hair(not auburn, more like a darker solid red) that goes untamed down to his lower back. He also has the same color wings, making him look something like an angel rather than a demon. He wears a vest usually, red with black trim and apparently made of colored leather, open in the front, with holes for his wings in the back. He also wears red pants, average, not tight or baggy.
Ablities: Not much really. Like a Phoenix, when he dies of natrual causes(old age, ect.), he burns into ashes and is then reborn from them, which explains his age. He flies very well, and his quickness, reaction times, and hand-eye coordination are far superior to a human's, although his strength is rather lacking. His sight is also far better than most others.
Personality: Almost completely silent. He doesn't really like anybody, and it's rare that he even trusts anybody. He's very easy-going. However, he steps up when he is needed, and does what he has to to survive.
History: Born way back when the vampires where still expanding. He's one of the few demons who remembers those times, and it makes him all the more desperate to stop this. Most of his life, he's done what most Phoenix demons do, just fly around, going with the flow, ect.
Allegiance: Demons
Other: nothing really

Ty'Lan
--------------------------
Ty'Lan sighed. The sunset was incredible, and his keen eyesight made it even more amazing. The cold breeze blew his long red hair back and blew ripples in his clothes. He felt great, he was finally free. During the day, like most Phoenix Demons, he hid underground, his long red hair and massive height made him hard to disguise. In the night, he could do as he pleased. Right now, he sat on top of one of the buildings humans called skyscrapers, one foot on the ledge, resting his upper body on his knee, staring at the setting sun.
However, with the vampire's new activity, he was always on edge. He rarely walked on the ground, where the vampires lurked. It may have been cowardly, but Ty'Lan didn't live for two millennia by not avoiding danger. In the distance he could see a pair of humans trying to fight off a vampire, one with a sword. A vampire hunter most likely. For a while, Ty'Lan watched, completely safe. I don't have anything to do with this. My people have lived for eons by avoiding danger, I have to do the same... he thought to himself, remembering the stories his parents told him of wise old phoenix demons who lived for tens of thousands of years, seeing much, knowing more. He wouldn't live to achieve that if he was always so reckless. So he watched, part of him straining to help. Still, the rational part of him understood that even if he did try, he would likely be killed, and for what? A pair of mortal humans who would probably die in 30 or 40 years anyway? Ty'Lan spread his wings to their full span, over ten feet, and flew off. However, as he flew, his mind was elsewhere. The vampires... Ty'Lan remembered when they were this offensive. Thousands of phoenix demons were killed just for a vampire's fun, including many of Ty'Lan's friends and family. The last time Ty'Lan saw a vampire was when he was hiding in a small indent in the sewer. He heard his friends' screams as vampires massacred them. Ty'Lan remembered the bloody pale face, gnashed fangs, looking for him. He remembered his horror, praying that somehow he wouldn't be noticed. Just remembering that made Ty'Lan's blood run cold. He shook his head. He would not let himself get sucked into this war...

[Outlaw JT]

Ashram Marduk(Hammurabi to elder vampires)
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Ashram looked down on the city from his perch on its highest tower. No one could see everything from up here but he could see more than most. His eyes scanned the city for any signs of the demon hunters. It did not take long for him to find one but any hunter would not suffice. He had to send a message and for that, only the best among the hunters would do.
He continued to look over the many rooftops of Pernicious for what would be his prey. There were too many hunters out for his taste on those rooftops. Most of them he could see to be young and weak but some were not so helpless. It was those that he would hunt tonight.
He watched until he found what he thought to be a suitable target. One that moved with not only skill, but experience. That would be his mark, his example.
He leapt from the tower and glided down towards his prey. It was nearly a mile away but that was an easy flight for someone like Ashram. It took only aminute to reach the rooftop he had targeted. With a soft thud he landed on the roof, announcing his presence.
"Not very subtle," the hunter said, turning to face Ashram.
"Tonight requires no subtlety hunter,' he replied coldly.
"Doesn't it?" the hunter answered back with a slight chuckle. "Perhaps you haven't heard of me bloodfiend. My name is Fal'ghi. I believe you'll regret being so forward."
The hunter unsheathed his blades as he took a step forward. He took another step forward. He hesitated then, pausing to examine his opponent.
"It wouldn't really be sporting if you don't at least draw your sword," Fal'ghi said nervously.
"That won't be necessary," Ashram said, extending his fingers out evenly.
In a flash he flew forward with invisible speed. Before the hunter could even flinch Ashram plunged his hand into the mans chest. Before the blood could even flow Ashram had impaled the hunter four times with his pointed bare hands. Ashram took a step back and swiped his hand sideways.
Everything froze for a moment but then a wide spray of blood spouted out from Fal'ghis throat. The huner froze there stunned, unable to move. He opened his mouth to say something but only blood bubbled forth. Finally he collapsed to the ground a mere two seconds after Ashram had first moved.
"I would've expected more from such a reputable hunter," Ashram said flatly. "No matter though. You will serve my purpose quite well."
Ashram hefted the bleeding corpse over his shoulder and leapt from the roof of the building. He fell the 15 stories and landed roughly on his feet. He found the nearest manhole and hefted it open with his free hand, tossing it aside like a pebble. He disappeared into its darkness with the body in tow.
~~~~~~~~~~~~minutes later~~~~~~~~~~~~~~~
Many of the eldest demons sat quietly in their meeting hall. They had gathered to address the matter of the vampire population. They were waiting for the last few members of their council to arrive before beginning. By the time those members got there though there would be something else for them to discuss.
Suddenly the double doors at the rear burst open and a body was thrown all the way to the front of the room, crashing into the wall. A dark form marched down the aisle after it, cold and intimidating. It made its way to the front of the room and turned to face the assembly of demons. Instantly they all recognized who it was.
"I came to deliver a singular warning! The rise of demon hunters in the city above is unacceptable. I have gone to great lengths to assure that vampires have left your youth alone, to make sure that my kind does not prey on yours. I suggest you do the same. Put a stop to all hunter activity or this fools fate shall befall every last hunter you send into the streets above!"
The room hung in silence. Many wished to say something but most were unable to find the words. Finally one of the demon elders rose.
"You can't expect us to keep every...." just as quickly as the elder had stood Ashram had charged his place in the back of the room from the podium in front.
His words were cut short as he found Ashrams straight hand piercing through his throat. Ashram withdrew his hand and the demon elder gurgled blood as his form slid back to his seat, motionless save for the flow of life fluid.
"I can expect whatever I wish to. Would anyone else care to question my orders?" Ashram said with frozen hatred.
No one else thought to stand or say anything. Ashram held his hand, coated in demon blood, up for the assembly to see. His wicked smile was small but visible. He stared over the demon assembly, giving anyone else a chance to object. No one did though.
"Very well. Remember my words demon elders. I will not permit my kind to prey on you but disobey me and I assure you I will command them to wipe your seed from existance!" Ashram paused one more moment.
He let them all soak in his words and his malevolent presence. Finally he turned and exited the way he had entered. He disappeared into the darkness of the world below. He had given the demons much to consider.

[Samchu]

Name: Sam
Race: Vampire
Age: 20 in human years
Looks: clicky (http://www.bbc.co.uk/cult/buffy/buffystuff/images/littlethings_big.jpg)
Abilities: Agile, stealthy and has a good sense of hearing
Personailty: Very aggressive and arogant. He's not a social person and will avoid contact if possible. Loves to see others suffer. A loner who follows his rules his way, no matter what anyone else tells him.
History: He was abandoned as a child, people believe this is the reason he turned out the way he did. He was only five when it happened and he didn't understand why. He became enraged and began to wreak havoc and destruction. When he didn't get very far he moved to Pernicious and began a killing spree. For five years he murdered the citizens of Pernicious and was never caught, until one day when he was caught comitting the murder. Whilst he was making his escape down an alleyway he was jumped by Vampires. By the time the cops caught up he had already been changed.
Allegiance: Vamp ruler supposedly but kinda freelance too
Other: carries a sword with a long blade

Sam
~~~
I smiled as I kicked the lifless body off of the roof. Vampires are supposed to hide the bodies of their victims but not me. I like to display it where everyone can see and this street is perfect. Although deserted now, it would be packed with people tomorrow.
I took out a small cloth and cleaned the blade of the knife. Of course, to avoid getting punished from breaking a vampire law I make it look like a murder, a stabbing.
I put the knife away and made my exit from the building, scanning for my next victim.
I heard the clashing of blades as I passed and alleyway. It sounded tempting so I headed over.
A vampire was fighting against two demons, feran emons if I'm not mistaken and beside the wall, a human-no. Half human half demon, very nice indeed.
I quickly decided to 'assist' this over vampire, I'd make off with the girl afterwards, a half-demon, half-human would be a nice catch.
I drew my sword and entered the alleyway.
"Two demons on one vampire? Are you really so weak that you need to gang up on us now?" I questioned.
The two demons looked at me, only now becomming aware of my presence.
I walked over to the other vampire. "I'm gonna evn the ods a bit and muscle in on this fight."
I looked at the two demons and held my blade in front of me. "Bring it on."

[Bulbasaur4]

Dhaeraow (Perya Morwen) - F - Demon/Human
*^8^*^8^*^8^*


As my back hit the hard slabs of the concrete wall, I felt a slight pain shoot up my back. My vision blurred for a fraction of a second, but instantly the demonic blood with in me set the vision correctly and I could see easily once again. My hair was strewn about in my face, as my eerie, starting cat-like green eyes opened and narrowed at the vampire figure. When our swords had clashed… he had pushed me backwards… and now he was walking forward. I saw my opportunity…
I pretended to be severely injured, wincing horrible and falling myself to the side to act as if my spinal cord had fractured or enabled me to move. I remembered how it still seemed extremely strange that this vampire didn’t go for a kill… it was as if he was trying to disable me- but why? Vampires aimed to kill… why would he treat me any different than a normal demon or human prey? It didn’t matter however… he would not capture nor kill me. As he came forward, I could tell in his walk he was confident he had hurt me enough so that I couldn’t move… and the old, ‘injured wing’ trick was working. As he approached closer, I waited to leap upwards… and then stab him straight in the chest near his heart and tear it through… a move which would require all of my speed- but it did not work.

The reason was simple- interference. Suddenly two shadowy figures leapt from the sky above, and landed. One in front of the vampire between me and my pursuer, and one behind the vampire had landed. The recognition of what they were stabbed me and pierced through my mind easily… it flared up with in my mind at the recognition of my own half blood- demons. It disrupted everything… sure they could probably take on one vampire and it would help me, but then it would be me against two. They were demons… and demons did not take kindly to a half kindred. There was only one half kindred… and that was me. I kept with my act however, and still let my body lie motionless on the hard cold ground. The demons moved in slowly upon the vampire who was quite shocked… but then yet another figure joined the party. A vampire came into the middle, landing next to the one w ho had pursued me. This vampire seemed a bit more cocky as he smirked and gazed at the two other demons and spoke, “Bring it on!”

I watched, as the demons and the vampires exchanged a mixture of blows. My eyes watched fasinated... as I kept pretending with my injury. I watched as the demon who seemed more female was sent flying into a group of trashcans by the older vampire (the one who had chased me here), but as soon as she hit the trash cans, she seemed to leap back up and head right into the action. The male demon was skillful, but the new vampire had lashed at him… and the demon seemed a bit rusty in his techniques. Still, he was skillful enough to hold his ground…
They’re fighting… they probably don’t remember I’m here anymore.

It was a perfect opportunity to get away.

I had no attachment to these demons who decided to leap into this… perhaps they wanted just to kill a vampire- or maybe they just wanted to kill me too. What ever the reason, I wasn’t about to be held at the mercy of vampires or demonics. I slowly raised to my feet, and pretended to stagger incase any were watching… and then as soon as the demons and vampires clashed together again in a beautiful display of fighting techniques, I dashed off down the oppisite direction of the alleyway.

It was a dire move… a move to get away that could easily fail and rarely succeed. I could only hope they were distracted enough to not pay attention… but after a few free seconds- perhaps 20, suddenly a shadowy figure leapt in front of me. I stopped immediately, sliding to a halt and immediately sensed the evil intentions among the figure. It was the vampire who had pursued me earlier… the one who would not let me get away. For the first time, he spoke to me… his voice dry, battered and rather gruff. Blood dripped down his face, as his chest rose and fell as blood drenched his clothing- the demons must have cut him up badly. But he was still able to survive…
I gazed back quickly, to see the two other demons attacking the one vampire who remained behind… and they were held busy by that vampire before able to perhaps attack this one who had pursued me if they wanted. I glared at the vampire… as he smirked and spoke..
“ I… am not allowed.. to let you … get away..” He breathed heavily, and I quickly charged at him hoping he was weakened enough. But he still had strength.
He pushed me down to the ground with a swift kick to my chest, which caught me straight and knocked the wind out of me. I quickly rolled onto my stomach and tried to crawl up upon my feet again, but instantly I felt his hands around my waist as if to pick me up. I clawed to get free, scurrying to get loose and I was getting out of the grip of his hands… and he knew it. So instantly he tackled me to the ground, as I felt him reaching for some thing in his pocket as if to bind me as his hands seized my neck and his body weight pressed me to the ground.

I gritted my teeth, and knew I couldn’t move…
But yet… some thing could…

I felt the metallic presense upon my back, and knew they were strong. The one thing that was not commonly known… or rather, the one thing I never understood was why they were made out of metal. Demons did not have metal built into them… humans did not either- but for some reason, the gift of metallic wings were placed upon me. And they were as sharp as daggers if they were to open abruptly and you did not get out of the way…

A howl of pain screeched into the air- extemely louder then I thought he would cry out- but it was cut short as blood gurgled into his throat and soon his cry was cut off as he could no longer breath, and then died. My wings had abruptly jerked upwards to my summoning, and spread out widely and straight upwards like a butterfly flipping it’s wings up… but my wings were deadly sharp at the tips. The tips of my wings… metal-like feathers, had sliced clean into his chest in multiple places and I knew that one of those places were in his dead heart. Even a vampire couldn’t survive that… along with the length in which my wings had entered his body which was quite deep.

His body was limp… and I felt his hand go cold around my neck, and soon I had scrambled from underneath him, my wings caught with in his bones and his flesh, but soon I jerked hard and my wings came loose from his body. I panted heavily, as I walked away… a faint limp in my walk as blood still was damp with in my foot. Gazing back, his dead pale body was upon the ground… blood spilling the area. I could feel his blood was upon my back as well… small streams of thick liquid blood running down my metals wings, oozing like some slime. I kept my wings spread outwards, so that the blood that dripped would land upon the ground. Flecks of blood were in my hair and face as well, but I did not care. My eyes were their narrow, melonchally gaze again… as I looked at the demons and the vampire to see what they were now doing…

[Outlaw JT]

Samchu: Your last post is not accepted. It is not generally allowed to either power RP or make another player's character look stupid. You managed to do both in your last post. Please delete it immediately. If you wish to include other peoples characters in your post you need to show them proper respect. How many well trained and experienced hunters do you know that slip in the rain? Consider this warning number one. Three strikes and your out of the rpg.

[Asilynne]

Name: Brandy Summers

Race: Vampire

Age: 24

Looks: Dark reddish brown hair, light green eyes, 5'8", 130 lbs, usually wears a black shirt with the hospital logo on it, black jeans and a white labcoat. Sometimes wears glasses, though she doesnt need them, theyre just for 'show' ^-~ also has black gloves that she uses when shes working

Abilities: basic vamp stuff, night vision, good sense of smell, aura sensing, the usual

Personailty:Somewhat bitter, but very determined, seems to be cold at times but mostly is just a bit anti-social. Wants to help people because it was her dream back when she was human, but now she pretty much does it to keep a part of her humanity intact. She doesnt want to lose herself to the monstor shes become. Usually tries to keep her distance from people, fearing that theyll either find out what she is or shell lose control and start killing people. Has a very strong will.

History:Was a normal high school student until the night after graduation she was coming home from a party and got bitten and changed. After realising what happened she refused to accept that her life as a human is over and started taking night classes at the local college to get her doctors degree. Met her husband David when she was walking home from Pernicious University late at night, he offered her a ride since the city could be dangerous at night (she found that out the hard way in high school LOL) and things went from there. At first she resisted getting involved with anyone due to the nature of her species, but eventually fell in love with him and they got married. Has kept her secret under the guise of a very rare and mysterious disease called Xeroderma Pigmentosum (or XP), which is an inherited skin disorder that impairs the bodys natural ability to repair skin cells damaged by Ultraviolet light. Any contact with sunlight causes anywhere from mild sunburns to pain and blistering upon immediate contact with sunlight. It affects not only the skin, but the eyes as well. Coming across this disease one night in a Medical Journal, she has used it as her 'cover story' ever since she was changed. Hasnt even told her husband the truth for fear he would loathe the creature she is. She works the night shift at a local hospital, as an expert in human Genetics. Lives to get revenge on the vampire that changed her, and also to someday find a way of reversing the genetic affects of Vampirism and lead a normal life as a human.

Allegiance: Freelance

Other: Not much is known about the disease that is her cover story, so no one has really questioned it. Oh and one more thing, shes not happy about being a vampire and because of that and the fact that she wants to hide what she is, she rarely uses the abilitys vamps have, unless someones life is in danger or its absolutely needed.


~~Brandy Summers, MD~~
Genetics Lab II
:::Shortly after nightfall:::
ATTCTGAAAGCCTCGCCTAATCGAGAGCTCGATTCAGCTAGCGACGATCG ATCGTAGCGACGATACGAGCACGATCGATGACGTCGTCAGCGAGCACAGC AGCATGCTAGCTACGATGCGTAGCATCGCGAGCAGCGTTCTAAAGCTCGG GTCATAA
I squinted my eyes as I studied the computer printout of the section of DNA I was working on. Nothing.....NOTHING!!! Everything looks perfectly normal, where did human DNA end and Vampire DNA begin? Where is the point that the DNA has been altered?! It was so frustrating, every night was a disaster, every night was another dead end. I was no closer to finding the answer than I was a year ago.
Vampires. To some, no, really to MOST, that was a laughable idea. Imagine, dark overlords of the night swooping down to feast upon helpless humans going about their innocent lives. Indeed, a laughable idea. To MOST.
TCCGAGATTCGATCGGATCGGCTAGTTTCTGTGCTGTGGCATCGATCGGG CGTATCGACTGGGCGCTACTATTACTGACTGATCTTCGGTATCGGCTAGC GACTGCTGACGAAGCGTAGCTACGGCGGCGGACGGACGATTCGCGATCGG CGGACGCAGCGTGAGCGATCGCGAGCGATCGGCGAGCGAGCGAAGGTCAG CGCAGCGAGCGAGTTT

But I knew better. I knew Vampires were all too real. I knew that vampires didnt care whether or not a person had dreams, whether or not a person just graduated from high school, and was about to embrace the world and really begin their life. Vampires didnt care if you wanted to have a husband and a family one day. They didnt care if biting you and turning you into one of them would make every day of your life a living hell. I knew that all too well.

ATCGACATCGGATGCTATCTATATCGATCTGACGTTCGCCGCGATCTACT TAGCGAGCACAAACGCGACTTCGAGCAAGCGACGACGGATTCTATCAGCG ACGGAGCAUCGATG-------

Wait a minute.....U?!

"Dr. Summers!"
I jumped, startled, and instinctively looked up at the person who called my name, losing my place in the process. Frustrated, I took my goggles off and threw them across the room. "YES! What IS it?! I was just BUSY THATS ALL!!"
Dr. Lombardi shifted her weight and sighed. "Im sorry for disturbing your work Brandy. I was just showing the new medical examiner around. Dr. Lancaster, this is Dr. Brandy Summers, head for Human genetics."
I looked at Dr. Lancaster, who reguarded me with a strange look. "Rather young for such a prestigious position, dont you think?"
Dr. Lombardi laughed. "Dont be fooled by how young she looks. Though she looks like she just got out of high school she actually has taken 6 years of medical school plus private study. I wish I could keep my youth like she does!" She said the last with a laugh.
Dr. Lancaster looked at me again. Something about that look I didnt quite like, but I couldnt place what was wrong with it. "Quite." He said. I was starting to feel dizzy, I started to sway from side to side. I almost fell over....but then Dr. Lombardi's voice brought me back to my senses. "Brandy...your not looking so well. Why dont you take the night off? Youve been working non stop for days....I bet your husband misses seeing you. When was the last time you and David went out just the two of you?"
I nodded, knowing she was right. I really did need to take a break. Smiling I grabbed my coat. "Thanks, I think I will."
As I left I felt the eyes of Dr. Lancaster still on me.....

~~~~~~~
~~~~~~~

Before I left though, I needed to take care of something. I was very hungry. Going into the bathroom I pulled a plastic container out of my purse and opened it. It was blood, and though I hated being a slave to it, I needed it to survive. I grimaced as the cold thick liquid flowed into my mouth. My instincts told me the blood should be warm, and full of life. Well that was just too bad...

~~~~~~~
~~~~~~~


The sewers spewed steam as I walked down the city streets the 5 blocks to the apartment where David and I called home. On the way there I thought about what I hoped to do. I had to find a way to reverse the effects of being a vampire. Then I wouldnt have to hide in the dark, lie to my husband, drink blood.....
Suddenly I stopped. Blood. I smelled it. It was fresh. I turned my head to look into the alley I was passing and saw a body there. Looked freshly murdered. My instincts were crying for the fresh warm blood oozing out of the victim, someone killed it just for me it seemed, knowing I was hungry....
A thrill of panic went through me. NO!!! Im human!! And Im gonna stay that way!!! In a panic I ran from the area, leaving the body, the scent of blood, and my hunger in the dust. I didnt stop running until I flung open the door to the penthouse and slammed it after me.

David heard the noise and stood up hurridly, throwing his book down. "Brandy! Honey whats wrong?! What happened?" He put his gentle hands on my shoulders trying to calm me down. But what could I tell him? "N...nothing. It was just...a shadow startled me. Ive been working too hard..." I hated lying, it seemed like thats all I did. I turned my head away. I managed a weak smile and kissed him on the cheek. "Im ok, really."
He looked at me for a minute, then smiled. "Well, next time you get off work early, try calling me to pick you up. Its better than sprinting down the streets at night." He said, giving me a wink. I smiled and hugged him. While he couldnt see my face I frowned sadly. I wished I could tell him, tell him everything. But I couldnt, ever. I couldnt let anyone know what I truely was.

That the thing I was really running from was myself.
~~~~~~~~~~~~~~~~~~~~~

Hope thats ok for introduction post! ^-^

[Bulbasaur4]

Oh, I drew a picture of my half demon/human char. It isn't anything special... I drew it quickly in biology while listening to our teacher go over some stupid notes before we had to leave. Go here to see it:
www.angelfire.com/crazy/shweet/drag.jpg


Name: Tella Me'arauko (Means, "Last Light Demon" <- the name she gives herself. Her true given name at birth is Martye Coia tel'tehtar, which means Destined Life of the Signs)
Race: Light Demonic Being ( The last of her kind... here's the scoop. In the beginning of demons, there were actually two forms- the ones today, known as the dark demons, and the light demons. They were virtually the oppisite of each other... and did not take a liking to each other as well. Then when the vampires rose to power, and organized the government which all demons and vampires know of today, the light demons refused to join. They refused to go under the rule of the vampires quest for dominance.. .and because of t his, the vampires and the dark demons slaughtered the light demonics until they were wiped out completely- accept for one, Marte Coia tel'tehtar. The has happened so long ago however... that none remember it, except for the ancient of vampires... VERY ancient vampires...)
Age: Unknown
Looks: Attached in attatchment below! She looks just like that, especially when she's about to transform. When she's hunting, she wears those clothing some times... but in the regular day, she wears light blue jeans which are stretchy and soft, along with a white tank top with thin straps to hold it up. She has silver earrings with in her ears, along with light brown sandals which fit to her feet and do not come off as easily as other sandals. Her hair is usually down during the 'resting' hours, and she has a tattoo around her wrist of a white wolf, surrounded in whispy smoke. (the tattoo itself is very small.)
Abilities: She has the ability to transform into five different animals- wolf, horse, hawk, cat and the last one is unknown. All of these transformations however, have one very distinct thign in common- her forms all all albino with crystallic, icy blue eyes. She's also extremely fast and agile. She also can stay in the daylight- an adaptation which makes her different from modern day demons. Light demons are built not rather for fighting more less are more peaceful... at least, they used to be until they were killed off.
Personailty: Very quiet, she does not talk very much unless she needs to or when she does her voice is soft and rather down-to-earth. Her expression is always like it is in the photo (below), but a little deeper in thought as if always thinkingto herself. She's full of guilt about the past and pain from it... and it takes a while for her to truely trust those whom want to be her friend. She's kind and not cruel, but it takes a while for her to warm up to people.
History: She was born when the Light Demonics still existed, and was raised by their inner clans. When the war broke out, and the light demonics began to dwindle... they sent her into hiding, where she hid and trained herself until the war wa sover and her species was nearly extinct. She remained 'low' for several hundreds of years... until finally she reimmerged into the modern streets when the humans now existed. She's been living among them, avoiding contact with demons and vampires a like, but during these modern nights and days she's becoming to realize she can't hide anymore.Little else is known about her.
Allegiance: None
Other: She has a metallic sword, which is thin and nimble yet beautifully crafted from ancient times. The handle is made otu of an unknown jewel, clear in color yet swirled in the inside with inner whisps of violet and cyannic blue. The blade of the sword is also clear, but the inner swirls mixed inside of it are a light shade of eerie green and cyannic blue. Carved into the sword are light demonic symbols... which are unknown to what they say but they are simmilar to the figure of a wolf- just more symplistic. Another thing about her, is that light demons are fast but they have a very serious weakness- they stand out. Unlike the demons of today, her kind stand out to any species. Whether she's in a crowd of people where you can barely see her or alone in the streets, she stands out like a beacon. Some thing about her always attracts attention... which makes it virtually impossible for her to hide or try to blend in if she's trying to avoid some one.






Tella Me'arauko - F - Light Demonic
***

The dark has fallen...
I thought slightly, as I sat upon the rooftop, dangling my legs over the edge slightly. The moon showed itself once again... and I gazed at it sadly. How many years had it been since that moon rose... and everyone had fallen? Everyone... and I had been alone?
Too many to count... far too many, more then I wanted to recall...
I took out my sword, and watched as it glistened in the moon's light, still sitting upon the edge of the rooftop upon one of the largest skyscrapers in the city. No one would see me here... unless they were looking for me, or happened to want to climb the tallest buildingin the city- which was highly unlikely. Gazing at my swirled sword, I sighed... remembering the time when the sword wa some one else's, and not mine to touch nor look at. But they had given it to me before they died... and now I was the last to wield it.
The smell of blood was upon the air- but it was that way every night. Even high up into the night sky I could smell it... and it was disturbing. Mixtures of human blood... but occasionally it would be vampire, or even demonic blood as well. The slaughterings which occured each night... which only went away when the day time came.

Even though the day time was not harmful to me, I prefurred to sleep at day. I never felt comfortable to sleep during the night... there were far too many things lurking in the shadows for me to ever feel safe to sleep in a bed at night ever again.
For they will always be lurking...
Shaking her head, she continued to gaze at the moon... pondering about how many more y ears it would be before some thing decided to give in the world... whether either the humans would perish, and the vampires would conquer... like history repeating itself, or would some thing else...



[attachment deleted by admin]

[Ultimate Charizard]

Keruga'Vyorn
-----------------

The Vampire had attacked, swiftly and showed much skill in his style. He seemed intent on me and Sakea hung back incase she was needed. Without warning a second figure jumped from the rooftops around us and joined the fight.
After a little taunting he too began to attack, focusing on me our previous opponent had decided to attack Sakea. "Sorry bud, you wont get an easier fight over there" i smiled to myself as he narrowly avoided being decapitated by the crescent moon's.
I focused back on my opponent, manuvering around Sakea's battle was now behind me.
My opponent was good and as it began to rain he seemed to be aiming his attacks low, causing me to improve the speed of my footwork. "If your hoping for a slip you can forget it, im not just a hunter, im a cat too" i grinned. He swung up violently and i took a bad cut to my side. I spun from the blow and kicked him harshly in the gut as i roared with pain. Leaping high i planted one foot on the wall next to me and used it to spin high, connecting with the side of his head with a viscious kick. He span away into the alley and was lost in the darkness.
I turned to help Sakea but she too was unconcious against the wall. The Vampire and his prey had moved on. A scuffling followed by a loud scream came from round the corner. I followed the sound to find the Vampire with numerous wounds. The woman stood there with metallic wings dripping with blood. The vampire was down, unconcious but alive wit h numerous wounds. I was about to raise my sword to end the job when i heard another blade being unsheathed. It was the woman, a demon of some decription. She wielded an elegant weapon, a slim silver blade that shone even in the darkened alley. I stepped back, allowing her the kill and with precision the blade whistled through the air before cleaving the Vamp's head clean off.

"Are you ok?" i asked as she dropped to one knee, the injury to her foot evident. She simply looked at me with venom in her eyes, as if she now decided i was to be a foe. I stepped back but she did not move so i went to check on Sakea. The Vampire i thought i had dealt with was approaching her unmoving form. I drew my gun and fired one shot directly ahead of him, causing a 'stitch' mark on the wall. He turned and hissed at me before dissapearing into the night. I did not know why i had spared the evil creature but i pray it would not come back to haunt me. Either way i would not be so mercifull next time. Clutching my side i knelt beside Sakea and tapped her face. Unconcious she had once again changed to her human form, a defence mechanism Feran had developed. Should we fall asleep or become unconcious in our demon forms our bodies automatically changed, much better if a human found an unconcious human than a Cat beast.
I lightly slapped her face and shook her shoulders. "Hey" i said softly with a slight worried laugh in my voice. Her eyes fluttered open. "Guess i really am gettin rusty" she groand as she rubbed her head. "How'd we do?" She asked.
I smiled as she looked at me. "We won i guess, for now. One vamp ran, the other is meat"

[DarkTemplarZ]

Ty'Lan
----------------------
Ty'Lan just flew. He wanted to wear himself out completely, to leave his thoughts behind... But he couldn't. Something urged him to fight, a deepset instinct that told him that what he was doing was cowardly. Still, he didn't do anything. The two forces raged within him, his instinct, which called him a coward repeatidly, and everything that he was taught in his life, which told him to play it safe, that he was doing the right thing. After all, the elders, some who were over a hundred thousand years old, knew best... didn't they?
Disgusted at himself for his questioning of the elders, he dove toward the ground full speed. Normally, Ty'Lan would have found this exhilerating, but he couldn't, not with the war inside him. Suddenly, an idea sprung inside of him, causing Ty'Lan to pull out of his dive. Elder Michizu'Yu. He had always helped Ty'Lan through his problems before, hopefully he could help him again.
I should be going back anyway. The sun will be up in under an hour he thought, floating down to the ground, entering a sewer. This was always the worst part of the day for Ty'Lan. Walking the sewers after a night of freedom, reduced to hiding in the bowels of the city. Still, there was nothing else he could do. He entered the underground through a crack in the sewer wall. The ancient tunnels stretched out before him, but Ty'Lan knew what to do. He walked almost endlessly, until he reached an open cavern. Here, in the semi-darkness, sat Elder Michizu'Yu, studying a massive book, written in strange runes Ty'Lan couldn't recognize.
"Young Ty'Lan. What brings you to me? Much conflict, I sense in you..." he muttered softly, not even taking his eyes off of the huge tome.
"Yes sir. I have come to ask for your guidance. Tonight when I was flying around the city, I saw a vampire hunter battling a vampire. I don't know why, but I had a sudden urge to help, to attack the vampire..." Ty'Lan started.
Michizu'Yu looked up, looking suprised, pained, and even a bit pleased. Ty'Lan looked at him blankly.
"I knew this would happen some day. The warrior blood in you is causing much confusion..." he said, suddenly turning to the tome, searching furiously for something.
Questions popped up in Ty'Lan's brain like crazy.
"Warrior blood? But I thought we were a peaceful people!" Ty'Lan exclamed.
"That's what we want you to believe. We never told anybody why the vampires were so bent on killing us during their last uprising. Children, like you, are brought up believing that because it was part of our peace treaty with the Vampires," he said...

OOC: I'll finish this tomorrow, it's late... must sleep...

[Ultimate Charizard]

Ill let it go this time DarkTemplar but next time try not to rush the time on too fast.
Incase you didnt notice theres a whole thing going on that will take time to resolve and any Vampire char's are gonna have a hard time posting when the sun is up.

It can be worked around this time i guess just be a little more considerate.

[Drusilla]

~*~Drusilla~*~
Ah, the night. I watched the battle below. I'd found many years ago it was useless to run into those things while there were weapons out. The large scar running down my left arm was proof. The girl, however, intrested me. She wasn't completely human, I could tell that from the start. But she developed wings. Her expression hid it, but she was not used to it. I was most definatly intregued.
I lept down from the building to the alley. They all turned to me, weapons raised.
"I am not here to harm you," I said softly. I was disguised as a vampire hunter. I had the skill that I could pass off for one. I was dressed in black leather pants, tall boots, a sleeveless black shirt, and a trenchcoat. The Ferals sniffed at me.
"Vampire," growled the female.
"Yes, dear, I am. I hope you don't take it personally. I rather like it, and I do try not to offend people with my state of being," I replied cooly. "Are you all right?" I asked her, noticing her slight injuries. It was more of a polite rhetorical question.
"None of your business!" she snapped back.
I laughed softly. "Oh dear, we are waspish aren't we? No matter. That was a freelance vampire, I have nothing to do with him. I'm not loyal to anyone; you buy my support. When your money runs out, I'm likely to kill you. It's the only way to survive anymore. Well, as there seems to be no permanent damage here, I'll leave. Of course, if you ever need me, just ask around. Ask for Drusilla," I turned on my heel, jumped up to a fire ladder that hung over the alley, and swung myself up to the roof with catlike grace. I was thankful that, yet again, the Feral hadn't taken the chance to kill a vampire. It would be rather bad for business for me to die completely.
I ran accross the roof and jumped to the next. I hoped that I had made an impression. Doubtless, they had heard of me. It was nearly impossible to be in this city for more than a few days and not hear of me. Even the humans knew of me, though they did not know what I was. No matter...
I made it back to my apartment an hour before dawn. I climbed in the window and pulled down the shutter. The night hadn't been wasted... I grabbed a carton of Ben and Jerry's from the freezer and plopped down on the couch to see if there was anything good on TV. Nothing... nothing... nothing... I gave up and put my Slipknot DVD in. I never got tired of it... Soon, I fell asleep, only to be awakened by a phone call many hours later...
~*~

[DarkTemplarZ]

Originally posted by Ultimate Charizard
Ill let it go this time DarkTemplar but next time try not to rush the time on too fast.
Incase you didnt notice theres a whole thing going on that will take time to resolve and any Vampire char's are gonna have a hard time posting when the sun is up.

It can be worked around this time i guess just be a little more considerate.

My bad, sorry about that. I'll wait till everybody catches up a bit to finish the post

[Ginger Cat]

*is, as usual, lost*
Ah well...
Please excuse the short post; I'm too feckin' tired to do much at all.


Farson Marrinor
------------------------------

So many, many people. They walked as I walked in a sense; one foot, then another foot. It was different too, though. I walked more swiftly, more like a shadow of the night than they could even comprehend. Some saw it, yet none knew what it was. So much the better.

Straying away from the main crowds, I started toward the park in the center of the town. Taking a victim was much better when out of view of the majority of the public. There was something about the drawing of the blood that fairly screamed for solitude, for its own scene. Death was beautiful, a work of art.

Often those who were to be taken fought against death, but this could not keep them from being taken. The urge was too strong in me, and no matter how demonic they found the process, they ended up loving it. To be taken in such a manner was to be a given a passionate death that could be matched by no other.

It was receiving and taking all at once, sharing an experience more intimate than any other. Why would anyone shy from it?

These thoughts running through my mind, I started into the park. It was one of the most beautiful city locations at night; perhaps one day I'd leave the city for the real outside, the forests. This, as I could see, would be the truest asset to my lack of fear for the sun...

Soon. For now, the park would work well enough.

[Samchu]

Appologises for very bad posting earlier. Promises not to make stupid mistakes again.

Sam
~~~
"Dammit, I had that demon..." I growled as I walked through the shadows.
I couldn't believe I'd lost the fight, I hated the thought of losing to a demon, especially when my reward would have been a half-demon half-human hybrid.
I kicked a can, it slammed against one of the walls. I looked up at the sky, I still ahd some time left before I usually made my retreat. Maybe the demon hunters have gone...
I decided to go back. I wanted that girl, the one who was half human and half-demon, every vampire did, and I'd get a reward if I happened to be the one whol delivered her.
I went back, sticking to the shadows on the rooftops. she was still there, surprising actually. Unfortunately so were the demon hunters.
I dropped onto my stomach and watched in silence. The second she was alone, I'd get her.

[Bulbasaur4]

Dhaeraow (Perya Morwen) - F - Demon/Human
***


I watched as the male demon went to the female one and asked her if she was okay... and then a vampire named Dru came suddenly out of no where. It caught me off guard- all of this happening at once... until the vampire left us alone once again with our thoughts.

Well that was rather quick.. I thought, as my eyes squinted in the night air but no trace of her was left.
Instantly the two demon hunters stood up, the male helping hte female and I quickly decided perhaps I should leave. Taking a step away my wings quickly retracted with a rather loud 'snap!' blood spattered in the air- left over from the now dead vampire, and sprayed the ground as a few more drips finally landed upon the concrete. This got the male demon's attention, as he looked at me.
"Where are you going?"

He asked, as I quickly stopped and gazed at the two. My icy, cat-like stare was rather full of bewilderment... as if it wasn't obvious. The question strangely caught me off guard however...
" Away from you demons... "
I continued to walk away, but strangely the female spoke.
" So you're just gonna walk away from us? After we helped you with those vampires?"

I stopped dead in my tracks, and felt the red hot flaming fingers of anger grab at me... sighing deeply, trying to control myself I turned around to face the two. My dark, violet hair hung in front o fmy eyes as they narrowed to give a cold stare- the one I've been using for a very long time with the likes of demons and vampires.
" First of all, I didn't ask for your help and I could have taken the vampire by myself. Secondly... I don't know why you decided to fight- but if it was so you could take me down yourself, then I'd rather leave before the half kindred kills me like they've been wanting for so long."

I stood there, gazing at them as if challenging them to speak anymore- but I didn't expect them to. Again, the male surprised me with an astonishing question.
" Why would we want to kill you?"
I turned my head away, almost to laugh at such an empty statement.
" Aren't you just like the rest? I've been hunted all my life by the likes of my half kindreds and the vampires which hate both. I don't understand why tonight the one vampire wished to disable me then just simply kill me like the rest used too... but whatever reason it does not matter. Answer your own question. humans kill me because they despise demons and the thought of demon blood mixing with their own makes them want to destroy the mere thought of it. Vampires hate both demons and humans, so why not take two birds with one stone and kill me? As for demons... who knows- the thought of tainted blood by mortals? Betrayel that their species would dare put their own spawn into human flesh? I do not know but I know this: I do not trust my half kindreds. Just ashamed."

With that I turned around, my metal wings glistening the the slight moonlight and began to walk away...


(I'll let Gav decide if he wants my char to stay or not. ^^)

[Mewtwo-D2]

Sorry I'm late!
Name: Siv Kismet
Race: Human
Age: roughly 28
Looks: Long blond hair, ice green eyes, very Norse in general... Generally wears a light blue shirt, baggy khakis with plenty of pocket space. Has a veils-and-jewels, smoke-and-mirrors rig for when she's fortune-telling, but she doesn't wear it for common clothes. Also has a tatoo of an ice green, seven-pointed star over her left eye, and wears a necklace with the Fool card hanging from it.
Abilities: Is pretty good at fortune telling ^^;
Personality: Goodnaturedly greedy and self-serving. Her reason for getting involved is basically that no vampire needs the services of a human fortune-teller, even one that is semi-accurate. So, basically, she plays nice with others so she can get what's best for her.
History: As a baby, she was abandoned on a doorstep and taken to an orphanage. There, a social worker with a literary mind named her Siv, after the golden-haired goddess of Norse legends.
Around the age of 16, she met an old man who was telling fortunes; he told her to draw a card from his tarot deck, and she drew the Fool. He told her that kismet had drawn her to him to start her new journey in life. She told him she would be his apprentice if he could guarantee a high income. He told her a good fortune-teller could command any price she desired, and she left the orphanage to become his apprentice. He is still her main boss, but he's quite old now and in failing health.
Allegiance: Herself.... ^^; Freelance
Other: Carries her equipment in her pockets: tarot cards, tea leaves, crystal ball, etc. Always be prepared to sucker someone out of their money, as she says.


Siv
~~~~~~~~~~~
I looked up from my dinner as I heard screams and other such ruckuss from outside.
"It's a busy night tonight," I commented, going to the window to light the lamp. "Maybe it'll attract some customers."
Despite my superior skills, business had been lax for the last few weeks. Vampires were getting more bold, and few people wanted to hear their fortunes told during the day. It was so much more mysterious at night, but who was going to brave vampires to find out if the cute cafeteria worker really had been eyeing them?
"Maybe I'll attract a vampire customer..." I smiled to myself. I had never tried to read one of them, so it might be interesting. That, and vampires were supposedly lavish spenders.

[Master Rudy]

There's been a minor change in my profile. However it's nothing too big. Just something I failed to mention at first ^_~

Name-David Summers
Race-Human
Age-23
Looks-Stands at about 5'11". Has short blond hair, hazel eyes and wears glasses. Normally wears a grey t-shirt with blue jeans and a denim jacket.
Personailty-Very easy to get along with and is friendly towards just about anyone. Despite this he might get a bit of a temper if he feels that someone is being mistreated. He's the type that doesn't believe in certain things and thinks most things can be explained easily. However if you show him hard facts chances are he won't argue with you.
History-Works as a photographer for a local newpaper. He met Brandy about three years ago. Despite her telling him it was a bad idea he eventually convinced her to go out with him. About a year and a half ago the two of them got married. Has no clue about the existance of vampires and that some of his friends and even his own wife are not human. The only thing keeping him from learning about his wife's secret is a very convincing and well thought out cover story.
Allegiance-Freelance
Other-Has some knowledge and training in martial arts from when he was younger. Back in the day he was the top in his class. However he lost intrest and eventually quit. Because of this he's extremely rusty due to not training in several years. Chances are David couldn't hold his own against someone else who is stronger or has much more experience. Despite his weaknesses he is a quick learner and could become a decent fighter if he stopped slacking.


David Summers
------
To a normal couple this could have seemed odd. However to myself and Brandy it was just an everyday thing. She'd come home and then after about an hour or two together I'd be off to my own job. It was all due to her condition known as XP. It didn't take long for me to learn about it. However in the three years we've known each other I had found out that Brandy was a real trooper. Despite having a very rare disorder she made the best of things and was living a normal life like many other people. It was a bit sad that we couldn't do some of the things others did. However it made no difference to me. It wasn't like it actually changed who she was.

While I was getting ready I saw Brandy looking at the shelf I had for my movies and books. "Well I see someone went shopping while I was gone" she had said as she looked through my new books and commented on them. With a chuckle she said "First off we've got Rainbow Six. I guess 20 Bond movies wasn't enough for you was it?" I shook my head and told her "You also can't forget Mission: Impossible." Moving on she came across something I had been wanting to get for a long time. "Not a bad pick. You got the Lord of the Rings trilogy. However being the lazy person I am I think I'd just wait for the third movie." I started to laugh over that when her suddenly serious look made me stop. "Something wrong?" I had asked her. All she did was hold up the third book for a moment before saying anything. "Since when do you read Anne Rice novels?" With a shrug all I did was say "I figured I'd try something different." Brandy looked over some of the book as I went to grab my camera. As I passed her I heard her whisper something to herself. Curious about it I asked "What was that about the book?" My wife just smiled at me and said "It's been a long time since I've read one of these." I must have been a bit tired myself because it sounded more like "This is all wrong. Who would read one of these?"

I would have liked to stick around and take the time to read one of those books but it was time for me to get going. Glancing at the clock I saw it was about 90 minutes before Brandy would be confined to indoors. I had to be at the office within the hour but it was more than enough time for the two of us to get some breakfast together. It had been awhile since we had a chance to do something like this. Since I knew how strange our hours were when compared to each other I knew there was no telling when our next chance to do this would be. Looking back at Brandy I said "Your not feeling too tired are you honey?" However she seemed to get the idea of what I was going to ask. The two of us were already in our car with me behind the wheel before we could even decide on fast food or some small diner.

******
15 minutes later
******
After parking about a block away Brandy and myself were walking to one of the local diners. As we walked I talked to her about her research on XP. I wasn't exactly a scientist but I could tell she was having problems with it. She always seemed to get stuck in the same spot. I was about to encourage her to keep at it when the sign of a nearby shop caught her eye. "A fortune teller. You don't see many of those around town" she said. I wasn't sure about Brandy but I didn't exactly trust them. There was no way to prove right there on the spot that they were telling the truth. I was always someone who liked to look at the facts about something rather than trust fate. Working with reporters as a photographer didn't change that viewpoint. However she seemed intrested in this fortune teller and walked it. Normally I would have made a comment about people like these but I figured it would be intresting to see one in action......
------

Not one of my best intros but I think it sets up the things to come for Brandy and David pretty well. It should be intresting to see what direction these characters go in.

[Outlaw JT]

Name: Taben Kaishin
Race: Demon (Vapor demon) - Vapor demons have a very different cycle of life from most beings. They only live to be about 30 but they advance at a highly excelled rate. Their life cycle is somewhat complicated and very limited. As one Vapor dies, their body becomes pure myst and it seemingly dissipates into nothingness. What really happens though is it reforms with new life. Over about a month that new life learns how to constitute itself as solid matter. That is how new Vapor demons are born. While this makes them very hard to truly destroy it also limits their growth as their numbers can never grow by any conventional or easily attainable means. The benefit of this method though is that each new Vapor that is formed inherits many of the skills that were learned in life by their predecessor so they get an early start in life, although no actual memories are retained fropm the previous lifeform. They are also quick learners so they are able to pick up most things they need to know in their short lives by the age of 5. The speed and agility of a Vapor demon is on par with the Feran breed of demons but their physical strength is lacking compared to most demons( it is slightly above that of the average human). However, they do possess the ability to turn their body's into a myst-like form that allows them to pass through solid matter. They can also convert any organic material they are touching into myst as well. When they revert to a solid state or when they lose contact with an object, the organic material also reverts to a solid state. While in this myst state a Vapor demon is able to enter anothers body and possess it. Only one with a strong mind and a stronger will can resist such a possession. The stronger the mind, the less time a Vapor demon is able to maintain this control. Any attempt at this can leave the Vapor greatly weakened though so it is usually reserved for an emergency.
Age: 24(in appearance and spirit), 7(actual age)
Looks: there is a pic attached below. His eyes are pure silver in color, the steel-toe part of his boots is actually made from bone but it is polished to look like chrome.
Abilities: (see Race)
Personailty: clever, mischievous, mysterious, loyal
History: Being only 7 actual years old his history is very limited. Most of it he keeps private but it is obvious that he has something of grave importance at the back of his mind. He is not from Pernicious but a similar city located in Austria across the sea. He has come to Pernicious seeking aide but he is reluctant to explain why to anyone. Not much is actually known about him here in Pernicious except that he seems to be an extremely skilled martial artist and he is trying to find the fabled ruler Ashram Marduk. He won't explain to anyone his reasons why.
Allegiance: Freelance
Other: He wields a sword known as the Kai-shi Scimitar. It is an ancient sword made out of wood from a long extinct tree. It is kept in a leather sheathe on his back. As it and its sheathe are made of organic material. It's sheathe is the same color as his coat, the blade is curved like an asian broad sword, the guard is dull grey, the handle is black and the blade is black with three fiery red stripes down each side. This blade has been passed down in his Vapor clan for longer than can be remembered.

OOC: it is much too late for me to type up a post now. Expect to one sometime in the next two days.

[attachment deleted by admin]

[Kuro Espeon]

FYI: I'm going to have my character interact with Rudy and Asilynne's characters. She's just going to trail them for now, so I can give Mewtwo or Asilynne a chance to post first.


Roku Veradim:
~~~~~~~~~
Suddenly, all of my senses began to tingle, sending an alert throughout me. I smelt it.....I heard it.....I could feel it vibrating through the air like an unmistakable aura that I could never forget. Yes...There was a Vampire nearby!
And what luck! It happened to be the same vampire that I had been trailing for days. I could tell because of the scent of her...a foul stench it was! All vampires had that lousy smell! I could tell they were coming from miles away. But for some reason, this one had managed to evade me up till now. Wether it was done conciously or by fault, it had begun to aggravate me. Unlike most vampires, this one seemed to move around during the day quite often, but I had a harder time tracking her during the daylight hours due to my human form. So she had managed to elude me during the time when my senses were not at their highest.
But that would end tonight. I could sense her smell, and she was very close by, obiviously unaware of my presence. But I smelled something else that sparked my curiosity. Alongside of her own, I found a human's scent! A Human? And it was still alive? That on it's own was puzzling enough, but there sheer fact that a vampire and a human were traveling together was down-right abnormal.
No matter...It was unlikely that this human would interfere. Not when I had a vampire in my sight.
I then spread my enourmous red wings and, giving them a mighty beat, I took off into the air and flew up to the roof tops. There I proceeded to glide lightly over the busy streets and alleyways below, my form hidden my the black velvet sky above me, scanning the ground below. I was narrowing in on my target! As I came closer I decided to land and take a more stealthy approach. I landed softly and silently on the pavement and continued on foot, keeping well in the shadows. As I turned the corner out of the back alley and out on the main street, I saw the pair I had been looking for. Yes! She was there! The vampire! The girl with dark reddish-brown hair and light green eyes, and a male human companion with Has short blond hair. I had found my target.
The two of thenm seemed to be rather friendly with each other. It was most likely that this human had no idea that he was chating with a vampire. The two of them were preparing to enter a small store whose front was decorated by strange and elaborate hangings and draperies.
I recognized this building. It was the home of the fortuneteller Siv Kismet, whose extravagant skills in divination were well known amoung the creatures of the night. But why would a vampire be going in there?
To avoid being seen I ducked back into the alley and watched from around the corner as they proceed to make their way inside. She was gone for now...but it didn't make much differance. They had to come back out sometime, and when they did, I would be waiting to welcome this vampiric ***** with open claws...

[Ginger Cat]

Farson Marrinor
----------------------------

"Beautiful, beautiful human..." I mused, stalking silently across the damp grass. "Beautiful, beautiful."

Most humans failed to realize the stark beauty of thier lvies, especially when compared with the so-called lives of those who walked around as vampires, as demons; the ones who were not alive as the humans were. Thier lives were brilliant, beacons in the night, passion in the cold. Yet most failed to recognize this on any scale. To them, they only lived toilsome lives, with death at the end. The true beauty of thier lives would forever elude them.

Unless, of course, a person were to be taken by a vampire. In the moments before death, the human would see the beauty of his or her own life before it was taken. In those moments, the human would not be remorseful. The human would be enveloped in the same passion that the vampire would feel, and both would be for the time drawn togetehr in an expression unmatchable by any other.

A human, a young woman, was seated on a bench nearby, her head hanging slightly. She was depressed; I could sense this easily enough. She was not yet an adult, and she hated her life already. She wished for death as many did, but with more intensity even than was common. However, she had not the entire will to die...

She would find her end soon. Walking over to her, I stood in the shadows, watching the light flicker slightly. "Clara." I spoke her name clearly and she looked up, startled.

"Who are you?" her depression had taken on a tinge of alarm.

"I am here to speak with you," I smiled bitterly. "Please."

Then she stood up and walked toward me, her eyes widening somewhat. "I..." She couldn't speak coherently, couldn't find words to express what it was that she wished to say. I needed no words from her, though. I could read it, could understand.

In some part of her mind, she understood what this was. She was frightened, yet she was accepting of it. This was everything she had wanted, everything she had feared. Stepping toward me, she moved without hesitation, finally standing before me with wide yet strangely empty eyes. "Please," she said, echoing the word I had spoken eerily.

Without another word I stepped toward her, wrapping my arms around her and lowering my head to her neck. As I opened my mouth and exposed my teeth, I felt her body fall against mine, felt her give herself entirely to me. Such a strange situation, yet it had happened before. She loved this, she knew now that she did want it.

Sinking my teeth into her neck swiftly, I gave it to her.

------------

...

[Asilynne]

~~Brandy Summers~~
:::Less than two hours til Sunrise:::

Queen of the Damned.
Interview with the Vampire.
These titles had echoed in my head, haunting me, reminding me of what I was after a night of almost forgetting. It was like a smack in the face, a scolding voice that said creatures of the night didnt deserve to be happy.

But I wasnt about to let some title of a book ruin my day.

David had to be at work in an hour. With him working by day and me by night, it wasnt often we got to spend a lot of free time with each other. I was thinking how nice it would be for the two of us to go out for an early breakfast before the sun came up and I would have to retreat into the darkness of the house to wait for another night. As if reading my mind, David looked at me. "Your not feeling too tired, are you honey?"
I smiled warmly and grabbed his hand. "Of course not! Lets go!"

~~~~~~~
~~~~~~~

A few birds twittered in the early morning dark as we walked from our car towards the mist-blurred neon lights of the small diner we had decided on. The slight chill of night still clung to the air, but my husbands warm hand in mine kept me from shivering much. I had to keep from laughing as my sensitive hearing picked up the low growl of his stomach. Well, somebody certainly is hungry, I thought as I smiled slightly to myself. I probably would be hungry too if I were human, as it was I had already fed once last night. Still, I looked forward to a nice hot meal, though I didnt really need the food to survive. It felt good to pretend I was human sometimes....
Suddenly something caught my eye. It was a Fortune Tellers booth. Back when I was about 7 or 8 my parents took me to a fair, where a fortune teller told me my future. "When your life begins, it will end, but continue in darkness." At the time that freaked my parents out, and from then on they shunned fortune tellers and taught me things like that were silly and had no meaning. The search for answers of all kinds eventually led me into science, and science had no room for matters of the occult. So I had no idea why I should be interested in this particular fortune teller now.
Without realising it at first I found myself walking in, the warm darkness of the shop lightly scented with inscense of some kind. I heard David come in after me and ask quietly curious what we were doing in here.
I honestly didnt know, something drew me in here, something I couldnt explain, and then I heard a voice.
"Ah Wellcome. Brandy Summers is it?" I jumped, momentarily startled at how she knew my name. Then David spoke and I instantly felt silly for being surprised. “Thats not very remarkable, considering she still has her nametag on.” He said, crossing his arms in disbelief. I smiled wryly. David never went for the whole smoke-and-mirrors thing, to him, everything had a logical explanation.
The fortune teller smiled. “Well David Im guessing your not a believer are you?”
Davids face fell. “What...but...”

I decided not to tell him his name was etched on the leather strap of his camera. ^-~

After we sat down, the fortune teller, whose name was Siv, studied us quietly for a few minutes. Her stare looked like it was seeing through us, it was like we were telling her all about us just by being in her prescence. It made me quite uncomfortable. I shifted my weight slightly and glanced over at David. He was sitting, slightly slumped in his chair, his arms crossed and looking back at the fortune teller with a skeptical look on his face. I smiled slightly and was about to tease him playfully a bit but then Siv spoke. “So. Tell me. What brings you in here? Nothing happens by accident, for everything there is a reason. So why have you come to me? What do you seek?” She looked at me first, waiting for an answer.

Why was I in here? I wasnt sure. Usually I find stuff like this to be interesting though I dont take much stock in it. So what did possess me to come in here? “I....dont know...” I said, sheepishly. She studied me closer. “You do. Though you might not know it you had a reason for coming in here. Nothing happens by accident.” She turned to reguard David. “And you, why have you co----”
Before she could finish he uncrossed one of his arms and pointed exaggeratedly at me. I chuckled to myself and Siv laughed. “I see. And as you will find, you will follow her in more ways than that.”

With that mysterious line she got out a deck of strange-looking cards. She laid ten of them in some sort of pattern and studied them carefully. She seemed startled at what she saw. She stared disbelieving at the cards for what seemed like forever, and then when she looked up what she said was haunting. “You have a secret, a dark one. This secret is shrouded in levels of deceit. Very soon the darkness will take over your life and envelop those you care about, the secret will take its vengance for never being brought into the light. You are ashamed of yourself,” she pointed at one of the cards, “Every day is a struggle, your consience pulls you one way while your being pulls you another. Because of the secrecy of your dark past, you will bring about the end you have worried about for so long.”

What was she saying...? Did she know, did she KNOW what I WAS?! She did, I saw it in her eyes. Horror crossed my features. What end was she talking about? What could this mean?

“Bullsh*t.”
Davids voice started me out of my worried thoughts. He sat upright in his chair and put his hands on her desk. “This is all Bullsh*t. I was thinking this might be a little interesting but this crap about ‘bringing about an end’? No.” He stood up and put a protective hand on my shoulder. “Come on Brandy lets get out of he--”

Siv looked at him with her haunting eyes and when he began to speak he went silent. “Disbeliever. The cards hold your future as well. Your world is about to be turned upside down. Things youve believed will fall apart as things you never thought possible come to your attention. Yes...you will believe soon. You will believe much that you never thought was possible.”
Davids eyes grew wide and then narrowed. “F*cking crap..” he said as he stormed out. I started to walk out after him when Siv stopped me for one last, final word. “He thinks he can protect you from the truth, from anything. But he has no idea whats in store for you, and for himself.”
I turned at the door. “What do you....”
She stopped me with a gesture. “He is the one that needs protecting. But in the end nothing you do will be able to save him from death.”
I felt like an icy hand closed around my heart. She went on. “But change is eternal. He will die, but he will live on....in darkness....”
The memory of that day at the fortune tellers from my youth hit me hard. “N...No...” I said and ran from Sivs booth in a panic. I wasnt watching where I was going and bumped into David hard. “Brandy!” He saw how frightened I was and grew angry again. “That damn fortune tellers full of sh*t. All they care about is swindling people out of their money and playing with their heads. Dont pay any attention to what she said. Nothings going to happen.”
I looked at him for a minute then nodded. “Your probably right.. I shouldnt let it bother me.”
As we continued walking towards the diner, I still couldnt help but think about what Siv had said. How the last thing she said seemed to mirror what that fortune teller had said about me when I was younger. I did die, and I did live on in darkness...

My life was a living hell because of that night after graduation. I couldnt imagine something like that ever happening again, the world wasnt so cruel that it would take all light from it....surely....
I shook that thought from my head. Ill never let that happen to David....

~~~~~~~~~~~~~~~~~~~~~~~
I know Davids a nice guy but I figured the fact that he thinks fortune tellers are full of crap anyway mixed with the fact that what shes saying is really worrying Brandy would get him a bit mad...sorry if hes OOC ^-^()
This is chock full of forshadowing in case you couldnt tell ^-~ lol
Im giving Kendo a chance to post the details of the tarot reading since shes the expert fortune teller ^-~

[Mewtwo-D2]

Siv
~~~~~~~~~
I frowned as the couple hurried away. I did so hate to be the bearer of bad news. But there it was... her secret would destroy them.
I sighed and shuffled the cards again. If they had stayed she could have tried to draw a second chance. But since they had left in such a big rush, I would have to do it mysef. Quickly I went over her reading in my head: Lovers, her strong relationship with a husband who wished to protect her. The Wheel of Fortune, inverted, the turn of fortunes that resulted in her condition. Justice, her sense of integrity that would end up destroying her. The Devil, the bonds of deciet she had chained herself and her husband in. Death, inverted, literal death, and the beginning of her life as a creature of the night. The Moon, ironically appropriate, on top of the knowledge of her future that she already had. The Hanged Man, inverted, her refusal to accept her nature. Judgement, a challenge to be faced... decisions to be made. And finally, the High Priestess, inverted, quiet, hidden power she would need tp find on her own.
I finished shuffling the cards and pulled the one from the top: The Wheel of Fortune... her destiny was circling wildly. Hopefully, she would consult me again before she was thrown, helpless, before fate/

[Master Rudy]

David Summers
------
As we sat there in the diner I couldn't help but notice that Brandy had not touched her food at all. This wasn't like her. Setting down my fork I told her "Look if this is about my outburst a little while ago I'm sorry." Shaking her head she said "It's not that at all David." I frowned when I heard her say that. "That fortune teller?" were the only words to come out of my mouth. Brandy seemed to have something on her mind and just remained silent. With a sigh all I did was sit there and think about that encounter.

Brandy suddenly spoke up. "David I know you really don't believe in those things but you've got to listen to me." Normally I would have found the way she was acting silly. However since when was my wife ever so concerned about something? She looked as if she had something very important on her mind. "I know you like to believe everything can be explained. However there are things in the world that can't be explained easily." Where was she headed with this? With a deep breath Brandy went on. "When I was a child me and my parents had seen a fortune teller. We figured it would just be something intresting that we could do for fun. What that teller said was downright chilling. She told me that when my life begins it would end but continue in darkness."

For a moment I let all that sink in. Was that why Brandy was freaked out? She looked as if she was going to say something when I spoke up first. "It's strange that someone would get that right. It seems to be refering to XP. People say you life doesn't really start until after high school. If I'm not mistaken you started to develop the symptoms around that time. I guess she was trying to say it would be the end of a normal life." Brandy just sat there for a moment and finally agreed "Yeah I guess your right David. I'm surprised you actually believe me." As she said that I looked at the clock. It wouldn't be long now. Brandy had to get home before the sun came out. After paying for breakfast we left and started to make our way back to the car. While I didn't say anything to Brandy I couldn't help but think about her attitude in the diner. Something was not right at all. I felt as if she was hiding something.

Little did I know just how right I was......

[Kuro Espeon]

Roku Veradim:
~~~~~~~~~
I watched from the shadows as the two went towards their car. I had followed them when they had left the Fortune Teller's place in order to study my target more closely. But I had to make my move, and I had to do it soon. For soon, the sun would be up and I would lose my chance, yet again, to fight her.
Over hearing parts of their conversations, I had heard her refer to the human as "David". I normal human name if I ever saw one. And he had called her Brandy. Brandy, huh? Not a very vampiric name...but it didn't make much of a differance...
Since I wasn't one for the cowardice of surprise attacks or ambushes (I liked for my opponents to have a fair chance), I decided to show myself. I slowly stepped out of the shadows and drew up behind them. I made a mental note to myself to make sure not to harm the human. This had nothing to do with him. Then...in a low, challenging voice I called out.
"Creature of the Night! Evil being of the shadowed city! I have come to avenge the lives of all the innocents that have been claimed by your kind! Turn and face me, vampire! Fight me or die!"
The two spun around, looks of shock and horror on their faces. I flexed my wings and smiled, purpousefully baring my sharp, dragon fangs, my blood red eyes shining under the remaining moonlight.
"Your reign of evil ends tonight! I, Roku Veradim of the Kage-Ryu Dragon Clan, will be your end!"

Please remember, Roku doesn't know that Brandy isn't an evil vamp. To her ALL vampires are evil incarnet and should die. Don't take it personally! ^_^

[Asilynne]

~~Brandy Summers~~

I was going to tell him. I started off by telling him about what the fortune teller had said when I was younger. I told him it came true. And then I started to tell him....the truth. What that prediction meant for me, and what it meant for him. That he was married to a vampire, a creature of the undead. I was going to tell him....
But as it turned out, he spoke before me. Assuming it was XP the teller was refering to, David went on to say it probably meant the end of a normal life. He had no idea....

After that I had lost my nerve. I wanted to tell him, I shouldve told him. But I didnt.

And now someone was telling him for me.

"Turn and face me vampire!! Fight me or die!!!" I froze as I heard that, David whirling around. I heard his heart begin to pound faster, the blood rushing through his veins at an incredible speed. "W...What..." It had to be something bad, David was not the type to startle easily. When I turned around, I saw that I was wrong.
This was VERY bad.
It was a demon, and by the looks of it it was a dragon of some sort. The huge leathery wings, the blood red eyes, and the sharp fangs made it a fearsome sight. But what scared me was what it had said. It knew I was a vampire! As David recovered from the initial shock he grabbed me and started backing up. "Im going to distract it....you get in the car, and if I dont make it back right away then start driving and get the police." He said in a hushed, intense sounding voice. But the demon wasnt going to let that happen. It strode up and grabbed David by the neck. "Stay out of this, Human, I have no problem with you." It tossed him aside like he was made out of feathers and he landed on the ground hard. The demon began to walk towards me. "Yes, your an elusive one, Ive been tracking you for days...but somehow you always managed to get away. Well, this time your mi----" The demon was cut short as David tackled it from behind. Getting it in an armlock he yelled, "Brandy!! Get out of here!!! I got him!!!" The demon twisted around and grabbed David again. "Him?!" It asked, sounding offended. "I am Roku Veradim of the Dragon clan for your information and I HAPPEN to be a girl." 'She' narrowed her eyes and brought David closer to her face. The fear in me was starting to give way to anger. "Why are you protecting this vampire? Is it because it has a spell on you? Or is it that your hoping it will TURN you! THATS why youve been travelling with it! Your no better than that undead scum!" The demon Roku brought up her clawed hand and was going to slash David. David would be killed. But the demon didnt count on my anger.
Faster than I could think I had the demon by the throat and lifted her off the ground. Surprised at my sudden course of action, she dropped David and he scooted back out of the range of both of us, his eyes wide with horror. "You leave my husband alone...." I said in a low angry voice, as I squeezed her neck and lifted her higher. The demon grinned. "So youve decided to show your true self, rather than hide in that lame human form..." She sneered, and once again I froze. My fingers relaxed on her neck and she pulled away, preparing to fight me once again. I looked at David, with a shocked expression on my face but it was nothing compared to the look on his. He looked like he was trying to talk, like he wanted to run, but he did neither. Just looked at me, like I was a monstor.
Which I was...
~~~~~~~~~~~~~~~

Im going to cut it short right here....heres how it stands, David knows shes a vamp, and her and Roku still have issues to work out, so Rudy and Sarah take it away!! ^-^

[Ultimate Charizard]

Sorry its been so long

Keruga'Vyorn (Gav)
-----------------------

The female demon turned and walked away. She wanted to leave that was for sure but why would she want to be alone? Something was going on. Attacked by two vampires and neither wanted her dead?

Sakea stood and was about to go after her but i put an arm on her shoulder. "Let her go, we'll tail her for a while, just incase there are more vamps after her but its gonna be light soon, the vamps will be goin to hide and i know a great cafe that does English Breakfasts, sausage, Bacon, Fried bread, the works!"
I grinned as she sighed "You always did think with your stomach"

"Yeah well then i have to get to work, i always go in early see if anything has shown up during the night...and i dont want to see you in the mens room again"
She laughed and then fell silent as we jumped back to the low rooves around us, quietly following the injured female.
As we continued i heard a scuffle, and someone shouting. Sakea snapped her head round, sniffing the air. "Dont get distracted, you follow our friend here, ill check it out. Ill meet you back at my apartment in an hour ok" She nodded and continued ahead as i moved off towards the sound.
I jumped to the floor and stood just within the shadows of an alley. A Draconis demon was out in the street, challenging a vampire. A human male stood close by. The vampires prey obviously. The vampire seemed reluctant, and outclassed with no real fighting stance.

A freshly turned vamp, the best time to pick them off, stop them doing too much damage. As i watched the human jumped up and stood before the Demon, seemingly shielding her. The Demon reached up and batted him away with ease and the Vampire screamed the humans name, her voice thick with concern. "Could it be, is she one of the 'Reluctants' a Vampire who only wishes to continue her human life" I had heard of a number that lived like this. Innocent enough with no desire to harm anyone, all they wished was to be left alone and for me that was not a problem, as long as they threaten noone i dont threaten them, i will not kill that which will not fight back.

This demon has no such morals however as i watch it stalk towards the vampire. My instincts say i should move to help but i decide to wait, to test this vampire. Is she as reluctant as she seems....

[Kuro Espeon]

I'll give this a try....I'm not too good at battle scenes...


Roku Veradim:
~~~~~~~~~~
"So youve decided to show your true self, rather than hide in that lame human form..." I sneered as she relaxed her grip on my neck. I landed on the ground and regarded her with an amused smirk. "You have quite a grip. But I'm afraid a good grip won't be enough to defeat me." I said, holding up one of my clawed hands in a threatening pose.
I glanced over at the human who was staring at the both of us with a look of shock and sheer terror on his pale face. I was obvious to me what was going on now. It seemed that that human was this vampires husband, and he was unaware of the fact that his wife was of the undead. She had probably never told him in order to protect herself. Though I didn't blame her...vampires weren't, how should I say?, very well liked...especially by they're prey. I felt sorry for the human. He could fallen victim to her appetite and any moment she chose.
But maybe - the thought occured to me - that maybe she hadn't revealed herself for another reason. What if...she actually had feelings for this human husband of hers and was actually able to control her herself around him to prevent from harming him. That might be possible...but just because she spared one life, didn't mean that she hadn't taken others.
Yes...I felt sorry for the human. For even though this Brandy was his wife, she was still a vampire, and therefore my enemy. And she must die...
But the vampire didn't seem as eager about this battle as I. The boldness she had just displayed was gone again, disappearing just as quickly as it had come. But nevertheless, I would make sure that she defended herself.
"Well, vampire? Shall we get this moving? The sun will be rising soon and I'd prefer for this not to take too long...and we ALL know how much you vampires hate the sun. Am I right?" I chuckled and grinned at her.
"Why..." I heard her say quietly, then slightly louder, "Why?! Why do you want to kill me? I never hurt anyone! And I never did anything to you!"
"Oh trust me, it' nothing personal, vampire. I simply hate you and your kind. And don't think you can fool me with that "I never hurt anyone" completely innocent act! I know perfectly well you are not innocent! All of you vampires need blood to survive, and you can't have lived without some source of blood! And that source is very abundant in a city full of humans, wouldn't you say?" On this last sentence I gave the human, David, a sideways glance, a small draconic grin on my face.
"Shut up..." Brandy growled.
I looked back her, the grin fading off of my face and being replaced with a serious scowl.
"Every one of your kind deserves to die. I dedicated my life to erradicating the race of vampires, the creatures that are responsible for my fathers disappearance! I will have my revenge!!"
With that last word I leapt up and, using my wings, propelled my self forward with tremendous force. I swung my clawed hand in a diagonal slash across her chest, which she managed to dodge. Regaining my footing, I attacked again.
"Come on, vampire! Defend yourself!"

[Master Rudy]

David Summers
------

This couldn't be happening. It was like a dream.....no. More like a nightmare. However I couldn't wake up. This was real. There she was with silver eyes, pale skin and fangs. At any other time I would have laughed over something as silly as this. But this was not a laughing matter. Despite what a sensible person would believe I knew I could not ignore what I was seeing. Vampires were real and Brandy was one of them. It didn't take long for me to accept the facts. The problem was wondering if Brandy really did love me. Did she actually see me as a quick meal for the future? As shocking as this was to me I still had the sense of mind to know I should smack myself for thinking that. Of course not! If she did then I was sure she would have bitten me the first night we met. With a sigh I said outloud to myself "So this is why you warned me and said our dating might not be a good idea on that night three years ago?" While I wasn't directing that question at anyone I just sat there as both Brandy and the monster called Roku looked at me. Ignoring her and focusing on only me she said "I was afraid that if I told you and if you saw what I really was then you would be afraid of me. I didn't want to scare you away." I still wasn't sure what to think of all this in such a short time. However I knew for a fact that Brandy was a good person. Getting up I told her "You should have just said something. Your my wife after all."

Brandy was about to say something else when suddenly Roku challenged her to a fight. It was clear that Brandy wanted no part of this. Roku on the other hand looked like she was out for blood. Seeing her go after my wife was the last straw for me. Right now I just didn't care about anything else. The only thing on my mind was protecting Brandy. I hadn't trained in a few years but I took up a stance and got between the two of them. This seemed to surprise Roku but it quickly gave way to anger. "So you'd throw your life away for her. What makes you think she won't thank you by draining your blood until you also become one of those evil demons?" As I took a small step forward I said "Well you don't know her like I do. I've known her for three years and have lived with her for almost two. Trust me when I say Brandy is not a killer. I think I'll go ahead and take my chances with my wife." Roku would not hear any of it however. "You truely are a fool. How do you think she gets her blood every night?" I didn't answer her because deep down I knew she couldn't hurt anyone. I would stand my ground and not back down. Roku just stood there for a moment and watched before saying "I will admit you've got a serious amount of courage. I didn't want to hurt you but if your going to protect her then I'm afraid I have no choice."

Roku took on her own stance at that point while Brandy just stood back and watched. I could easily see the look of horror and regret on her face. I knew she regreted not saying anything but I couldn't blame her. It's not exactly something that is easy to say. She also looked liked she was very afraid of what might happen to me. I was also very afraid because I had no clue about how the hell I was going to protect her from something like this......

[Drusilla]

Hmm... well, as has been pointed out, things are going to be intresting with the vampire characters not moving during the day.
Oh, and Ginger, when you get to it, can you clear your PM box so I can PM you?

[Shaka]

Name: Vaname S. Wilsh

Race: Demon

Age:about 600.

Looks:Red hair about the size of vash's, only he has bangs over his left eye. Eyes that look as though flames are reflecting off of them. Wears a black trench with cut off sleaves & red trime. Boots that come almost to his knees. and leather shirt and pants.

Abilities: Demon: can shape-shift, and turn into a wolf type demon
mainly the ears and claws (like werewolf)

Personailty:Layed back. enjoys going after priests. unknown most of the time..unpredictable.

History:Born in britian. during the dark ages, Vaname had many battles after being taught by the best class demons. When he was about 60 years old, another demon in his old clan killed his sister and mother because he was top demon in his time.

Allegiance:vampire ruler. He has not respect for other demons. so he may hunt them down for a little reward money.

Other:hangs out at pubs.
~~~~~~~@~~~~~~~~~~~~~~

The pub was dark and smelled of moist cigars, the dim ceiling was covered with smoke. I gulped my wisky down and slamed the shot glass down with a loud clash. The bar keep took a slow glance over and i grinned. I sat up and threw him what little money i had and started towards the door. Opening the door i saw what looked like some sort of street fight. Shrugging i put my hands in my pockets and looked at my feet as i walked. Without looking i bumped into a lady, "oops! Sorry miss." i said shifting my glasses so no one would see my eyes. Walking faster i bumped into another man spinning as i hit. Stumbling i walked faster, feeling blood go to my face. *Man im an idiot!*
~~~~~~~~~~
i guess i need to meet up with someone ^,^,

[Asilynne]

~~Brandy Summers~~
Just 8 short feet from the car....

I didnt understand.
But that was nothing new because I didnt understand a lot of things about this situation. I didnt understand why this demon Roku wouldve chosen me, out of countless vampires in this city, to want to destroy. Me, perhaps the only one in existance that DOESNT enjoy the immortality, that DOESNT revel in the feasting of blood. Me, who would be more than willing to trade eternal life as a vampire for a few short decades of mortal human life.
I didnt understand her anger, her past, her motives for wanting just ANY vampire dead. But the thing I understood least wasnt Roku at all.
It was David. He was risking HIS life, HIS mortal human life to protect me, even after knowing what I actually was! Deep down inside I knew he wanted to keep me safe, despite the fact that I was more likely to survive a battle as a vampire, because he loved me. But I had thought for sure that his love for me would have quickly cooled once he saw the monstor he was married to. Once he knew what I actually was, I figured he wouldve chalked the past three years up as a mistake and move on, maybe find a human wife, someone he didnt need to be afraid of. Because seriously, who can love a monstor who feeds on blood?
To my surprise David acted as if he never thought of any of this. As him and the creature known as Roku exchanged words, never once was the word ‘monstor’ mentioned by him. Instead he addressed me as ‘his wife’, as if he neglected to notice the fact that I was deathly pale, my eyes glinted with a strange silver shine, and the fangs that were meant to be used for biting humans were easily seen as I gaped at the scene. Maybe.... It started to dawn on me. Maybe he’s seeing past what I am. Maybe hes in love with not WHAT I am, but WHO.... I looked at David, instantly regretting not telling him the truth, and also my earlier doubting thoughts. When this is all over...Im going to apologise to you David, and Im going to tell you everything.

But I wasnt going to have time for reflection. Roku obviously wasnt going to go anywhere until I was dead, and if David got in the way she wouldnt think twice to kill him too. Looking at David, I knew he wasnt going to back down. He was determined to protect me, even if it meant dying to do so. And that was something I would NOT accept.
Putting a hand on Davids shoulder I stepped forward closer to the demon. She crouched lower, expecting me to make a move to attack. Instead I put my hands up, and, going back into my weaker human form, I addressed the demon in a calm but stern voice. “I dont know why your so hell bent on killing vampires, but if you need one for your sacrifice of revenge, then here. All youll be doing is ending the life of someone who never asked to be a vampire in the first place, but if you think you can live with that then do what you have to. Just let my husband live.” I turned my head to look at David, a heartwrenching look on his face. I tried to manage a smile as I whispered, “Im sorry.” I didnt want to die, but more than that I didnt want to see anything happen to him. Especially since this trouble began because of me, because of what I was. And it wasnt fair for him to die for something he never really got a choice about. He never chose to marry a vampire.
But right now David was choosing something else. Before I could say another word, he spoke up. “There will be no need for that Brandy. I may not know much about what the hell is going on here but I have figured out one thing...”
I stopped. What was he saying? Roku seemed to have an idea of what he might be getting at and nodded. “So you've finally come to your senses. I will say that I'm sorry about all of this but it must be done.” A thrill of fear went though me as I heard this. What was she....
But before I could think anything of it David broke in again. “No it won't.” He said sternly. “As I've said I don't know much about what's happening but I've figured something out......” David seemed to know what he was doing so I just watched him as he spoke fearlessly to the creature. “You seem to have a very high amount of honor and fairness. Chances are this could have been ended quickly with a sneak attack. Instead you've chosen to show yourself.” Roku seemed irritated that something was distracting her from the matter at hand and seemed anxious to continue the fight to the death. She crossed her arms and said somewhat bored, “Whats your point?”
David put an arm around my shoulders and turned around, starting to lead me away from the demon. Without turning his head he said to her, “It wouldn't be very fair to attack someone while their back was turned would it?”
I wondered at how brave David was when faced with things he didnt understand, and I hoped that bravery would be enough to convince Roku I wasnt one of the bloodthristy vamps like so many others.
In the end whether we got away or not depended on her desicions......
~~~~~~~~~~~~~~~~

Ok Sarah go for whatever you have planned! Oh yeah and thanks to Rudy for helping out on the last paragraph ^-^

[Kuro Espeon]

Roku Veradim:
~~~~~~~~~
The human turned his back to me, leading his wife away.
"It wouldn't be very fair to attack someone while their back was turned would it?” He said with a small smirk as they walked towards their car.
I was briefly dumbstruck, and I just stood there staring at him in disbelief. Then, a smile creeped onto my face and I burst out laughing. David and brandy stopped and looked back over their shoulders, obviously surprised to see me laughing. I broke my laughter breifly to speak.
"Ha! Clever, human! Very clever indeed! I like you, kid! You crack me up!" I started laughing again, throwing back my head. "Maybe I won't kill you after all!"
I stopped laughed and grinned at them. "But that doesn't change the fact that your little vamp wife still owes me a fight. Don't think yo can just turn your back to me and it'll be all over. I'm sorry but it doesn't work like that!" I paused, and crossed my arms over my chest. "However, I admire the amount of courage you both have and your willingness to sacrafice yourelves for each other. I see you really do love each other, and I respect that. But..that doesn't mean I can just ignore my duty, the duty I have to myself and too my family and my clan. Don't think I'll just walk away and forget this." I looked up at the horizon and saw the first pale lights of dawn in the clouds. I folded in my wings morphed slightly so that they were hidden again. "But seeing as it's almost sunrise, I don't think it's safe for either of us," I said loking at the vampire, "To be out and about, especially in our current forms. If I where you, I'd get shelter quickly vampire. That is...unless you want a really wicked sunburn!" I chuckled at my own joke and turned away from them, slowly changing back to my human form. "We'll finish this another night Brandy Summers. I assure you of that. So until we next meet...watch your back."

As I started walking away, I began to wonder about the true nature of this vampire. If she really wanted me to leave her alone...she would have to show me some proof that her heart was completely pure and free from vampiric evils. And to do that would be difficult. IN my mind still, all vampires, wether they chose that life or not, stillhad that evil desire buried within their hearts. And if they did not watch it closely, it would one day swell up and consume them.

She might be able to protect herself and her husband from me...but could she protect them from herself?

[Master Rudy]

David Summers
------
I wasn't expecting it to be this easy to get away. For a moment I had a feeling Roku would have attacked anyway. However my actions only seemed to amuse her. She may have been letting us go for now but somehow I had the feeling that we had not seen the last of her. For a moment me and Brandy watched from the car as Roku walked away and turned back into her human form. Once I was sure she wasn't going to try anything sneaky I started to speed down the street as quickly as I could. The sun would be up any minute now and I refused to have my wife get turned into a smoking pile of ash.

Now that the threat from Roku was over with it gave me time to think about all of this. I assumed Brandy also had much on her mind. Seeing how worried she was about me finding out I guessed she was now concerned over what I might say. Finally after about a minute of not talking I just laughed a little and said "I'm guessing that whole thing about vampires sleeping in coffins is just a myth?" Brandy just seemed a little surprised over how I was taking all of this and said to me "I have no idea how you can be so calm over this whole thing. I just don't understand it at all. Here I was thinking you'd be afraid of what I was. Instead your just acting as if you didn't care about the fact that I wasn't human." Keeping my eyes on the road I told her in a more serious tone "It's not an act Brandy. I'll admit I was very shocked when I first saw you back there. However it's the truth when I say it doesn't bother me. I've known you for three years Brandy. I know that you couldn't hurt anyone. What you are doesn't matter one bit to me. The important thing is who you are."

As we pulled up to our building I could see she was speechless. Looking at her as I got out I said "We can talk about this more once we're inside the building. I think the last thing we want is for you to get cooked by the sunlight." I knew there was no way Brandy would argue with the last comment about the sun. In only a few minutes we were upstairs and in front of the door to our home. However as I opened it Brandy yelled and jumped away as fast as she could. It didn't take long for me to find the source of her pain. Across from the door sunlight was coming in from an open window. Rushing inside I quickly pulled the curtain across it and cursed at myself for leaving it open like that. Something like that could have easily killed Brandy. As I went back into the hallway to let her know it was safe I saw her quickly turn away. "Please don't look at me David. Not like this!" she shouted as she held her left arm. I didn't see her face but her words and now pale skin told me what had happened. After being hit by the sunlight she must have lost her human form. As I helped her inside she just faced away from me the whole time. All I did was watch as Brandy sat on our bed and continued to face away.

I was quickly getting the idea of how much she must have disliked what she was when I sat down next to her. Before I could say a word or do anything she moved away from me. With a sigh I said "I've already said I don't care about what you are Brandy. Do you think you could please let me see your arm?" At first she didn't do anything but then reluctantly she came closer to me. From the looks of things her injury was not serious at all. At the most it was nothing more than your typical sunburn. Typical for humans I reminded myself. Despite the fact that I didn't know much about real vampires I had a feeling that another second or two would have been much worse for Brandy. She was lucky that she moved away when she did. Except for some soreness I knew she'd be ok. As I looked away from Brandy's arm to her face she started to turn away again. However this time I would not let her face away. Reaching out for her face I soon got Brandy to turn and face me. I noticed something as I looked into her now silver eyes. In her mind she must have figured they were the eyes of an evil demon. However to me they were the eyes of a beautiful woman. I couldn't resist anymore.

To the surprise of Brandy I leaned forward and kissed her.

Brandy didn't try to stop me or pull away. However I could easily tell she was shocked and not expecting me to do that at all. When I moved away she seemed stunned and spechless. After a moment however she threw her arms around me and hugged me as she spoke in a voice that seemed slightly choked up. "Thank you" she said as we hugged each other. If she didn't think I loved her because she was a vampire then I had just proven otherwise......

[Bulbasaur4]

Well... just assume my half demon char walked away from Gav's char. ^^; Wanted to post fer my light demon..


Tella Me'arauko (a.k.a.- Martye Coia tel'tehtar) - F - Light Demon
**



I don't know why I decided to leap down from the comfort of my high perch upon the building of the city to watch. It was just... fasinating, yet eerie all the same. Were times changing? Yes... but for the better? I was not sure.

I had sat upon one of the rooftops far away from the vampires, human and even the demons which I also had sensed. I tried to hide... although with my disability to stand out even when I tried to hide, I hoped that the conflict would be enough to suffice as a cover-up. And it was... I thought.

At the end, the demon eventually left the pair alone. The male human claimed he still loved the female vampire... and they remained. It made me smile...
They still loved despite their differences...

Perhaps times were changing for the better, and most vampires could learn to live with humans in harmony and even demons could learn to live in harmony with the others a well.
It is too late for the light demon race... I am the last. But perhaps the world is not destined with the same fate...
I thought, as I watched the couple. My icy blue eyes were quite curious... as they began to chat, but decided it was best to leave the place they were in and head for another location. They fasinated me... truly, they did.
Perhaps I should follow them....
I thought, and I liked the idea. I could track this vampire and human... I don't know why I would bother to do so, but in this day and age I had nothing better to do. I was sick of hiding... hiding from the demonics and vampires who remembed the Light Demons. But hopefully most had forgotten about the light demons by now... yes, most had. I was almost positive all had... perhaps they would see me as an abnormal human, since Light Demons had an aura about them that was more closely related to humans than dark demons.

I then closed my eyes... and instantly felt my body change.
My face shrank immediatly, as my legs also shortened and my arms did the same and both narrowed. My body became fuller with muscle, and I soon felt the abilities of grace and agility become more evident in my body. Fur began to sprout from my skin as a long, elegant tail also grew from my body... and soon ears sprouted from my head as my hair shortened and grew into white fur. My hands and feet formed into paws, as claws grew to replace fingernails and whiskers formed at teh tip of my nose. My eyes slitted... as the night time became easier to see and I was more alert of everything.

I was an albino cat... with the purest blue eyes any one could imagne for a creature.

Now to follow them...
I thought, as I gracefully leapt down several ledges until after waiting the right moment for the couple to pass me, I gracefully leapt behind them. My padded feet gently touched the ground as I traced them from behind... following them like a wary kitten who had lost it's way.

They had entered their vehicle however, but they didn't notice a little fuzz ball enter the car either. They were to busy with the life-changing event which had happened to them. As they drove away, I felt uneasy - I wasn't fond of vehicles, nor machines of any type. Holding my queezyness in however... I waited until it finally stopped. (It seemd to last foreverrrr...)
Then, when they stopped and left... i managed to squeeze out again.

I watched them carefully from under their own car as they left... and even though I could not see where they went inside the building, I could easily sense their auras which radiated quite brightly. I quickly leapt from ledge to ledge, following their aura from outside.. .until I came to a window. Blinking slightly, seeing the sun was out... or coming actually, I decided they probably would not open the windows any tiem soon- or at least, the vampire female would not. So, I laid upon the ledge... contently waiting... for what, I didn't know.

[Asilynne]

~~Brandy Summers~~
In the Summers' Room
:::A little after sunrise:::

All the way home I had looked out the window, not wanting to catch David’s eye now that he had seen what I really was. I had been afraid of what he might have been thinking, as he drove home as fast as he could. He had seen a lot of things he never wouldve thought possible, and the things he believed were true were proven to be wrong in a very short time. And though he said it didnt bother him, still I wondered. How can anyone be that understanding? Deep down inside I knew I shouldnt be surprised, after all, we loved each other a great deal. But I still had a hard time believing he could be so easygoing about it. After all its not every day you find out your wife is a creature of the undead.

We had gotten home just as the sun was breaking over the horizon. He had quickly rushed me into the building so I wouldnt become a pile of ash, and we climbed the stairs hurridly, relieved to be so close to home after that tense encounter moments before. But a carelessly open curtain let enough sunlight in to scorch the skin on my arm and force me back into my tru---- my vampire form. I was horrified. Here was another reminder to David of the monstor I was, as if he didnt get a good enough look before. As he led me in the house and into our room I felt horrible, like fate had damned me. I kept my eyes away from him, not wanting him to see the brand of my 'kind’, my silver eyes, but he wouldnt let me turn away.
And then, totally ignoring the sharp, dangerous, human-biting fangs easily seen as he leaned in, he kissed me.
And then it hit me: David wasnt afraid. Though I know he wouldnt lie about things, its quite easy to say something and then think differently after being faced with it. But David’s actions spoke louder than any words ever could. It was like all the doubt and fear and dispair I had felt was all washed away by the sense of relief and joy I now felt.
When it was over, I looked at him in awe. David was an amazing person. He seemed blind to my appearance and just gazed at me, as if seeing his beautiful bride on our wedding day. All the distance I felt I had to keep to prevent from biting him melted away as I flung my arms around him. I wanted to tell him so much but the only thing I could get out through my overwhelming relief was, “Thank you.”
After holding each other for a while, I pulled away gently, knowing the task that lay before me. David had to know everything. “David...Im sorry I never told you before, I was...afraid it would have scared you away...” I shook my head. I couldnt make excuses for myself. As I looked into his eyes I wasnt sure where to begin. How do you tell someone about the 6 years of horror, about having to drink cold, thick blood every day just to keep your un-life from being extinguished? Then I decided to start at the beginning.
“Your probably wondering how I became a vampire. I wasnt born as one. I was born a human just like anyone, just like you. I had dreams, plans for the future. I dreamed about winning the Nobel Prize for science, dreamed of one day having a family of my own, dreamed of days filled with sunlight and happiness. And then, on the eve of the beginning of my life, I was coming home from a graduation party, and in an instant, it was over. My dreams were over.

“The vampire came out of nowhere, or maybe it just seemed that way because I wasnt very aware of my surroundings. I was giddy with the feeling of freedom, and me and my boyfriend, who was walking me home, were laughing and joking as we walked. What did we care if we were loud? The only dangers the night held were getting in trouble with our parents by being out past curfew. Or so we thought...

“It happened so fast, I never got a clear look at the vampire. All I knew is that I had been grabbed and after feeling a sharp pain in my neck, I was getting slowly weaker. I tried to call for help, but then realised my ‘boyfriend’ was nowhere to be seen. He had run, leaving me for dead... My final thought before the last of my human life ebbed away with my blood was how very alone I was, and a choked sob escaped as I felt myself fade...”
David’s face grew pained as I re-lived my death for him. He reached out and took my hand, trying to comfort me. But there was more, much more, and it would get much worse...
“It felt like hours later before I actually came to again. I wasnt sure what happened, the party, the walk home, everything seemed like it had been a dream. I stood up shakily, a numbing pain resonating throughout my body, and I knew something was wrong. I was cold all over, my heart wasnt beating, and it was then I realised that I was dead, and the dream known as my life was over. I was horrified, wondering if I was a ghost, or just stuck in-between life and death, going neither to heaven or hell. As I soon found out it was much worse than that..

“I started to stumble home. I didnt know how being at home would help me if I was already dead, I just knew I wanted to be in a place of comfort, I had to get out of this bloody alley where I died. Had to get away, as if staying here any longer would make it easier for the Grim Reaper to find me and take me to eternal darkness. On the way there I realised completely what had happened to me. There was an old man sitting at a bus stop, reading the newspaper by the light of a streetlamp. I knew I needed help, I ached all over, so I walked to him. ‘Please sir, can you help me home?’ I asked, and he looked up. His eyes grew wide and he shouted ‘BLOODSUCKER!’ before dropping the paper and running. Watching his reflection retreat from me I saw that my reflection was missing, and I noticed something I hadnt before. I had fangs...

“It was then I knew for sure. I didnt know how it was possible that vampires existed, but I knew they did, and that I was killed by one and had become one. A part of me knew my home would never be mine again but I had no where else to go, so I went anyway. My father, seeing what had happened to me, was sympathetic, but I saw the way he looked at me as my mother hugged me crying. As if I would turn on them and bite them, my parents who’ve raised me when my birth parents gave me away, when the world decided it didnt want me. He looked at me as if I was a danger, and though Im sure he still loved me I knew he could never look at me the same way again.”
I paused a minute. I was growing weary of re-living my horrible past, and those terrifying hours of the night I died. Seeing David’s face made me almost lose it and burst into tears. He had no idea all these years what I had gone through, and I again felt bad for not telling him before. I looked down, and shook my head sadly. “David, Im sorry..”
David reached over and tilted my head back up. “Dont be. Its not exactly the easiest thing to talk about. I admit that if I hadnt seen the truth with my own eyes I probably wouldnt have believed it.” He stood up and reached a hand down to help me up. “But I did mean what I said. What you are doesnt bother me at all. I know you wouldnt hurt anyone, and if you had wanted to bite me you wouldve done it the first time we met. But Brandy....” he looked at me with a serious look on his face. “I have to know. Where do you get your blood?”
I nodded. That was a good question. I reached into my purse and pulled out one of the medical packets of blood and showed it to him. He took it from me and turned it over in his hands. “And you have to drink one of these every day?” I sighed. “Every day.” Was all I replied. After a moment he handed it back to me. He looked at a loss for words, then shook his head. “This is a lot to hear, and I have a lot of questions for you Brandy, but the world doesnt stop just so your vampiric wife can answer them all,” he said with a wink.
I smiled. “Yeah, I dont think your boss would believe that excuse for being late, you better get going. We ll have plenty of time to talk tonight.” I grinned and opened my arms for a hug. “Come give your wife a goodbye hug, dont worry, I dont bite,” I said jokingly, still in my vampire form. He laughed slightly and embraced me. Relieved at how understanding David had been, I could feel my usual mischevious side coming back. Deciding to play a little trick on David, I whispered into his ear, “Too much anyway...” and made like I was going to bite his neck.
He jumped slightly and, putting his hands on my shoulders, drew back to look at me with startled eyes. “Relax,” I said with a laugh, back in my human form. “You know I could never do that ^-~”
After a moment he laughed too, and grabbed me playfully. “That was mean, you had me for a minute there.” I laughed again, and, remembering some of the BS Siv had said, decided to joke around some more. “Well you know, since its going to happen anyway, why not let your wife do it instead of some stranger?”
This made David stop. He pulled away from me and looked at me with a slightly wary, haunted look. “What do you mean by that?”
I froze. Oh my. Thats right, some of Sivs predictions had come true, which made it impossible to totally disregard everything she said. Feeling again that sense of dread I looked at David, his expectant face waiting for me to respond. I had to tell him, he had to know.
He is the one that needs protecting. But in the end nothing you do will be able to save him from death.

“David, I may not be the only one that will have to live on in darkness...”
~~~~~~~~~~~~~~~~~
I finally got this finished!!!!!!! x.x It better be good too, this day hasnt been too good -.-
Ok Rudy, its your turn ^-~

[Ultimate Charizard]

Now im annoyed......i mean really fed up with this.

Its my RPG and your all making better posts than me ;)

....but then again whats new lol.

Keruga'Vyorn (Gav)
------------------------

I had almost made a move but the couple had surprised me. Showing surprising bravery in the face of a superior fighter they hoped to play on her sense of honour. Luckily for them the Draconis were quite an honourable race, some other demons, or even another Vampire wouldnt have thought twice about attacking their backs.
There was a group gathering, the three in the street and i swore i could smell one, maybe two others watching. This close to dawn it was not a good thing. The couple vanished around a corner and i heard the noise of an engine start up. The draconis too vanished from sight. I was impressed by the stealth of such a large creature.
I reverted to my human form and stepped out into the street. Looking around i began the walk back to my appartment.

I arrived home to find Sakea stretched out over a chair watching TV. "I didnt think you'd be interested in TV" I said as i threw my coat over the couch and she looked up yawning and stretched lazily. She grinned and turned her attention back to the television. "Cartoons.....theyre great" she stated as she watched. I sighed, "Still a Kitten at heart huh" i laughed and headed to the kitchen. She blew a raspberry at me and laughed. "What happened to the demon you were tailing? No trouble i guess."
"Nah" she called back "it was quiet, i think she was just heading home and her route took me close to here so i decided to head back, what happened with you?"
I told her the story of what had happened as i made breakfast and once i had eaten took a quick nap. An hour or two was all i needed and i headed out of the house by 8am. Sakea said she would do a little looking around, perhaps find herself a daytime job and promised not to be hanging around the Mens room again. I sighed as i picked up the signals of a running joke starting and closed the door, heading for the hospital.

[Kuro Espeon]

Roku Veradim:
~~~~~~~~~

This vampire hunting was getting to be very tricky lately. That race always seems to find someway to avoid us...

I sighed as I brushed my now all black hair back from my face and tucked it behind my ear. While I was in my human form, the red strands in the front of my hair changed completely black. Along with this, my wings were masked, my claws had shrunk to the size of normal human nails (though still slightly sharper...) and my eyes faded into a less noticable brownish-red. My skin was still rather pale, but thatvwas to be expected from someone who lives in the night. Unlike vampires, Dragon demons could stand to be out in the sun, but we generally avoid it anyway, for our true niche was in the shadows of the night.
I walked along the sidewalk in the busy downtown where the streets were already buzzing with life. Even though it was still early, many humans were already up and about, completely unaware of the events taht occured while they slept peacfully in their beds, and on their way about their daily routines. They were so peaceful...so carefree...so ignorant....
Watching them made me wonder: Does ignorance make you happy?
Putting on a long black trenchcoat, which I used to hide my attire, I made my way along the street walking towards my intened destination: The hospital. I was looking for someone...and I knew exactly where he was.
As I entered the building, several people turned and looked at me with strange and curious expressions. I was used to this, for even in my human form I had a tendency to stand out. But as long as my demonic traits were not showing it was fine. I passed by the front desk and made my way to the elevator, ascending to the fourth floors and stepping out into a long, white corridor. (Why do hospital hallways always have to be white?) I turned down one of the side corridors and found myself looking at a tall man in a white coat. I stopped at the end of the corridor and folded my arms across my chest. I grinned mischeviously and let out a low chuckled.
The hospital worker looked up at me, and I could tell by his face that he was not surprised to see me. He had probably sensed me coming.
"Thought I didn't notice you back there?" I finally said. At this he tilted his head slightly to one side.
"What?"
"I'll admit you were cleverly hidden. But...I know the smell of a Feran Demon anywhere!"
His eyes narrowed slightly at the mention of his race.
"I've been looking for you, Keruga'Vyorn of the Feran Clan..."

[Master Rudy]

David Summers
------
Despite the shock of the events of this morning I was very calm and understanding. After getting home Brandy had told me of the events leading to the moment she died as a human. There was still much I wanted to know but no time to talk. As I hugged my wife goodbye I jumped away when I felt her teeth on my neck. However the worry soon turned to laughter when I saw that she had gone back to her human form. While it was a slightly cruel joke I had to admit it was funny. However the joke ended very quickly with her next words. "Since its going to happen anyway why not let your wife do it instead of some stranger." Stepping away from Brandy all I was able to do was think about those words. Many things were in my mind as I thought about what she was talking about.

Does she want to turn me into a vampire?
Has another vampire been after me?
Is there something Brandy didn't tell me?

There was only one way to find out. "What do you mean by that?" I asked Brandy feeling slilghtly worried at where this might lead. If my first guess had turned out to be right I was sure she would respect my choice if I told her that I didn't want to be turned into a vampire. Brandy would never force me to do something I didn't want to do. However I had a feeling that she wasn't going to ask me that. As soon as she stopped laughing I knew this was very serious. "David....." she started to say with a worried look on her face. "I may not be the only one that will have to live on in darkness." Surely she wasn't saying what I thought she was. However as she explained I soon found out it was exactly what she was suggesting.

With a sigh Brandy started to talk to me about the fortune teller. "Remember when Siv asked me why I was in there? She asked you the same thing and all you did was point at me. Her words were along the lines of 'you will follow her in more ways than that.' Now that you know what I am surely you must have an idea of what she means." I wasn't sure if vampires were able to sense fear but if they were then I was sure Brandy could tell I was afraid. With a deep breath I started to say "Are you telling me that I'm going to......" However I didn't finish my question. There was no need. We both knew what I was thinking. I saw tears start to form in Brandy's eyes as she spoke. "I don't think I'll ever forget what Siv told me. After you left she made a comment on the fact that you believe you could protect me from anything. She told me 'He is the one that needs protecting. But in the end nothing you do will be able to save him from death. But change is eternal. He will die but he will live on in darkness.'"

For a moment I was silent as I went over those words again. However to the surprise of my wife I just laughed a bit. "That's a good one Brandy!" I said with a chuckle. "I knew fortune tellers were crazy but this?" Her expression turned to one of pure shock before she started to speak. "You can't be serious David. After all the things you've heard and seen you honestly think this is still a joke!?" I paid no attention to Brandy as I picked up the phone. I was already running late for work and I needed to try and cover myself. I wasn't sure what was said on the other end since Brandy was also talking to me but once I knew someone had picked up I started to speak. "This is David Summers. I know I'm running a bit late here. My alarm clock never went off. Damn thing was giving Brandy problems the other night as well. Can you tell my boss that I'm on my way now and should be there in ten minutes if traffic permits? Ok thanks." Once I had hung up the phone I turned to Brandy. This turn of events must have really upset her because at the moment she was blocking the front door. "Please don't go David. After what I've heard this morning I have a bad feeling about this." With another laugh I said to her "Hey there's no need to worry. I'll even bring home some things from the market for a nice dinner tonight." Brandy was soon crying again and shouted "BUT YOUR GOING TO DIE!!!" Trying a more serious approach I looked her right in the eyes and said "We both know that you can't stop me Brandy. The world is a dangerous and risky place. I've got just as much of a chance of being in a major car wreck or armed robbery as I do of being attacked by a vampire. Besides it's only a quick walk to the car when I leave later tonight. No more than five minutes. What are the odds that some hungry vampire is going to track me down in that time frame?" Brandy just didn't answer. I knew she was worried about me but there was no way she could stop me. As she stepped out of the way of the door she said "Just promise me you'll call before you leave to come home tonight." All I did was nod as I stepped out the door.

On the way downstairs to my car I thought about what Siv had said once more. Now that Brandy wasn't near me I could drop the act. I had joked around in an attempt to not worry had so much. However it failed badly and only made her even more worried over my well being. I was going to make it a point to let her know I was sorry when I called her tonight. This was not something to joke about after all the events of this morning. Siv was right. My world had been turned upside down. Things I believed had turned out to be false. I had gotten my first look at the things that many people believed to be nothing more than entertaining stories. There was no way I could think that Siv was just someone looking to make a quick buck with nothing more than lies. I couldn't ignore what she had told Brandy.

If the truth could scare me to death I would have had a heart attack before I could even leave home. The truth was that soon I was going to die and join Brandy......

[Ginger Cat]

*lost, as usual*
*shrug*

Farson Marrinor
------------------------------

Human beings are funny creatures.

Strange to think that I'd been one; now it seemed that I'd been a vampire for all eternity. Perhaps, though, this was what it was meant to be. Perhaps becoming a vampire had been a rebirth, was supposed to have been a rebirth, and the old life was supposed to fade away.

Certainly everything that I had left now seemed trivial. Much as I enjoyed watching these people, many of them irritated me. There were things they would never know. Things they never could know. Yet many of them seemed tothink they knew all... If I remember correctly, I'd hated them when I'd been human, as well.

Perhaps I hadn't changed entirely.

That wasn't terribly shocking, though. I'd seen very few other vampires, after all, and how was I supposed to learn if I'd seen no others? In a way, it seemed to be a fairly decent deal for me, though there were times when I wished to see another quite dreadfully.

I suppose I wasn't a typical vampire. Again, I didn't know, though. I could only go on the few bits I'd heard, and by what I'd heard, most couldn't stand the sunlight. It really didn't bother me terribly. I could feel the prescence of light like some sort of hateful mist, but I could stand that; I'd learned to.

Was I honestly a vampire, then?

No way to tell, not for me. I wasn't sure of what I was, but ah well. Currently, I was only heading back to the place I'd made my small home. I used it only during the day. Not to sleep, no, but to escape from the hateful mist of the sunlight, to sit back, to think.

Such an odd life.

--------------

[Ultimate Charizard]

Keruga'Vyorn
-----------------

I growled lightly but audibly as i picked up the scent of Draconis and realised this was the hunter that had been involved with the Vampire woman earlier.
"What could you possibly want enough to find me?" i said as i glared at this demon in disguise. She smiled and almost laughed "Now, is there any need for such hostilities?" It was true that we were technically on the same side but it was no secret that the different demon clans were 'reluctant' to mingle. And Cocky, ruthless demons like this one really annoyed me.

"There is when you interfere with my daytime life" i snapped and It was her turn to glare. "Life?" She began "You call this..'cherade' a life. Hiding under a mask, a false face as you 'earn a living' the human way?"
"And what does your day entail?" I asked, "Wandering the streets untill it is once again time to hunt?" She seemed to shrink into herself. "What i do during the day is of no concern to you"

"In that case could you please tell me why your here?" i tapped my hand on my wrist, although i never wore a watch i liked the impatient look of the gesture. "Why did you stand aside and not move to do your job?" she said as she stared at me with cold eyes. "You mean kill a defenceless couple? Thats not my style"
She glared once more "I meant to kill that vampire". "Like i said, a helpless couple" the demons jaw seemed to drop at my remark. "You could clearly see she was not a fighter, not a real hunter. What you are does not control what you do or what type of person you are."

The demon growled and her eyes seemed to glow. I allowed my face to alter slightly to my feline features and snarled in response to her challenge. She looked at me hesitantly and looked around. I knew she could not hope to fight me in such a small hallway, her demon form was much larger than my own, her wingspan alone would restrict her. Also the fact she knew my name meant she had heard of me and presumably my reputation for being one of the stronger Feran warriors.
She backed down and lashed out an arm to her side, venting her frustration and punching a clawed arm through a wall. I could not flinch at this show of strength and kept my glare in her eyes as she turned and walked off down the hallway.
I shook my head as i reverted to my human form and turned and resumed my way down the hallway. I had been asked to run a blood test sample over to the labs before heading on my break and as i got there i stopped. Something hit my nostrils....the scent of something familiar....

....Vampire!

[Kuro Espeon]

Roku Veradim:
~~~~~~~~~
Leaving a gaping hole in the wall, I turned my back to this
'high ranking' Feran Demon and walked away from him. I snarled to myself. How dare he talk to me like I was some low-level creature with no intellegence or morals! I knew very well his poistion amoung the Feran...but it was obvious that he didn't know who I was! Even though the Kage-Ryu Dragon clan was less in number than they had been before, we were still fairly well know amoung the creatures of the night. And one of the lords of the Feran should have been able to recognize me as the heir to the Dragon Lord Ryushin, leader of all the Draconis! And on top of that, I was also high-ranking officer of the Kage-Ryu Clan, and all demons knew that Dragon demons were not to be taken lightly.
Cocky, was I? Ruthless, huh?! I was tired of people treating me that way when they really didn't know me at all. That Fearn acted like he knew me! teh destructive, arrogant type with no regard for life! But...that wasn't me at all...I had my reasons for my actions and I didn't feel like I needed to justify myself to someone who isn't even willing to listen!
I curled up my fists and held them at my sides, staring straihgt foreward, focusing only on what was in front of me. Yes...that was the best way to live. Never let anything distract you from your goal. Don't let people tell you that you were wrong when they didn't know the truth. The truth about me...my past...and my life...
I 'hmphed' lightly. I knew what that Feran was thinking, but I wasn't going to fight him. I had no need for that, especially since we would be fighting in a human hospital. Despite what he may think, I was not heartless. I had no problem with humans, and I actually tired to protect them. I would not do anything to endanger their lives on purpose. Besides...even though we were from different clans, I had no quarrel with Keruga'Vyorn either. We were still on the same side, and fighting my ally would be a waste of time and effort and would accomplish nothing. I was not one for meaningless battles. The only vendetta I held was against vampires and that would never change...I would avenge my father...
But yet...something that he had said stuck out in my mind:
"A helpless couple....You could clearly see she was not a fighter, not a real hunter. What you are does not control what you do or what type of person you are."
For some reason I couldn't get this out of my mind...I guess in someway I related to this statement, and it made an impression on me. But...did it apply to vampires, as well?
I sighed as I slowly unclenched my fists ans relaxed them at my sides. There was no use worrying about it now.
I had just reached the elevator and I was about to push the down button, but then something caught my attention. My senes began to tingle and I knew instantly that something was wrong. I straighten up and spun around, my arms out to my sides in an attack position (I guess this had become a reflex for me). I looked left and right, trying to pinpoint the cause of the disturbance. Then I found it...and it was coming from the same direction from which I had come, the same place I had left the Feran. I sniffed the air curoiusly and my eyes widened.
A vampire!
My eyes now narrowed menacingly. Feran or not, I couldn't leave Keruga'Vyorn alone with this. After all...we were both demons and allies. I took off in a run back in the direction I had came.

[Master Rudy]

Hey Gav do you think that perhaps we could move on to sunset soon? There really isn't all that much that can happen until then IMO.

[Drusilla]

Hey everyone...

I'm majorly grounded and I no longer have 'net at my house. Rudy and Asi, go ahead with what we discussed a few weeks ago. I'm going to do my best to get into the library as often as possible, but I can't promise much... I live forty minutes away... :/

[Ultimate Charizard]

Yeah sorry Rudy.

Ill conclude the Day in my next post which will be tommorow. Im way too tired to post now (2 hours sleep last night)

I guess thats the problem with having 'Day walking' chars mixed with Vamp chars.

[Master Rudy]

Originally posted by Drusilla
Hey everyone...

I'm majorly grounded and I no longer have 'net at my house. Rudy and Asi, go ahead with what we discussed a few weeks ago. I'm going to do my best to get into the library as often as possible, but I can't promise much... I live forty minutes away... :/

No problem at all Dru. I know what that can be like not having net access. I'm sure all the former Dragon Ball VG members remember the time my computer was disabled by a virus early in 2002. Once night falls in the RPG me and Asi will take care of things ^_~

[Ultimate Charizard]

Keruga'Vyorn
-----------------

I followed the scent, it seemed to be coming from where i was heading. I looked at the sign on the wall as i entered a section of the hospital. It read 'BloodBank'
"Figures" i mumbled to myself as i carried the small container towards the reception area. Handing it over and signing the release form i moved over to a corridor, the scent was coming from down there, the Laboratories according to the sign on the wall. The Blood bank itself was down the hall behind me but the scent was coming most strongly from this Hallway. Although this vamp had been to the bloodbank its scent was very strong in this area which meant it was spening alot of time here, in the labs which meant it came here often. This vampire was after something else, not just a quick meal. I was about to head down to investigate untill the man on reception called me.
"Your not allowed down there Pal" he warned me. "The techs and lab workers dont like 'outsiders' near theyre work" He laughed "They dont trust people like us who dont have a degree"

I took one more look and headed back the way i came. On my way i noticed the Dragon demon heading towards me. "I suggest you leave, you dont have ID and theres nothing to see but the receptionist and his security camera" She growled as she passed and i heard her footsteps stop before they resumed again this time following me.
Now i faced two problems, a vampire this close to where i worked, and a demon who probably wouldnt think twice to disembowel it on sight and possibly blow my cover if i were here. Id have to come back tonight, when there were less staff around. I had to find out what this vampire wanted.

[Kuro Espeon]

Roku Veradim:
~~~~~~~~~

I followed closely after Keruga, my arms folded across my chest.
"Don't pretend like I'm not here, Feran!" I shot at him, my voice stinging. I show him any sign that what he had said before had affected me. "And don't assume that you can tell me what I should and should not do. You have no authority over me."
"I simply meant..." he replied, without turning around, "that there was no point in either of us hanging around right now." He obviously knew that I sensed the vampire. "It's still daylight and if we tried to take it on right now we would, undoubtedly, blow our cover. I dont think the humans in this hospital would take to kindly to two vicious looking demons, especially if we kill someone."
I sniffed audibly. "Don't you think I know that, Feran? For your information I wasn't about to jump ahead of myself! I agree that precaution is in order. Despite what you may think, we Draconis are not cold-blooded, ruthless killers who will start a fight at the drop of a hat. The exposure of our world is at stake, and I, as well as you, don't want that to happen."
"Hm!" Keruga replied in a somewhat skeptical air, "Seems you have some wits about you after all."
I clenched my fists at my sides, resisting the urge to beat him to a bloody pulp. But if I beat up one the doctors I would be thrown out for sure....I sighed heavily, trying to ease my aggrivation. "And you have quite a tongue on you," I replied, "That could get get you into trouble one day..."
"I plan on being careful," he retorted.
"Are you always this short with your allies? Or is it because I am of the Kage-Ryu? Come now, Feran...don't you think it's time to break away from the centuries of tribal fueding and accept the fact that we're on the same team? After all...we're both after the same thing."
"Not quite the same thing, I'm afraid.." he said, finally turning to face me. After a brief silence in which he stared at each other sternly, he continued. "What exactly is it that you want, Draconis?"
I grinned snidely. "I told you, the same thing as you. I want to know what this vampire is up to and I intend on helping you. We are, after all, both demons even if we are from different tribes. Speaking of which, I do have a name. You can call me Roku Veradim."
"I'll call you that if you stop calling me Feran." He replied, smirking right back. I chuckled slightly.
"Very well, Keruga'Vyorn...what is your plan?"

[Asilynne]

~~Brandy Summers~~
Nor heaven nor earth have been at peace tonight...
:::A few minutes after David left for work:::


*What mean you, Caesar? Think you to walk forth?
You shall not stir out of your house to-day.*

*Caesar shall forth: the things that threaten me
Ne'er look but on my back; when they shall see
The face of Caesar, they are vanished.*


I watched as the front door to the apartment I shared with David closed behind him, feeling as if I would never see him again. Despite my better judgement I had stepped away from the door and allowed him to leave for work. But he was right, though there were things out there that could easily harm David, I knew he couldnt just hide inside in the safety of our home forever. Hiding, always afraid of what may come, that was no way to live.


* Cowards die many times before their deaths;
The valiant never taste of death but once.
Of all the wonders that I yet have heard,
It seems to me most strange that men should fear;
Seeing that death, a necessary end,
Will come when it will come.*


It was times like this I wished I was able to wear my silver cross again. In the past, before I became this creature of the undead, whenever I needed comfort I clasped it in my hand. It reminded me that things would look up, for even in Christ’s darkest hour he stayed strong. I wished I had some of that strength now. I dont know why I took so much stock in what that fortune teller had said, but something about it struck a chord in my heart, as if events were in a pattern and the things the fortune teller predicted were the next to fit. I shook my head, knowing that worrying about him would only drive me insane, and decided to trust in the hope that my fears were just that, silly fears bred by the notions of a money grubbing fortune teller.

But that ache in my heart still wasnt going away...


*Calpurnia here, my wife, stays me at home:
She dreamt to-night she saw my statua,
Which, like a fountain with an hundred spouts,
Did run pure blood...
And these does she apply for warnings and portents
And evils imminent; and on her knee
Hath begg'd that I will stay at home to-day.
....
How foolish do your fears seem, Calpurnia!
Give me my robe, for I will go.*

~~~~



Usually after David left for work, I would go to sleep, because being up all night I would be tired, but this time sleep was not going to come to me easily. I knew I wouldnt be able to rest easy until I saw David safe tonight after work. But waiting and watching the clock wasnt something I was good at, so to keep my mind off my worries I turned to Davids bookshelf, and his newly acquired books. Carefully passing up the Anne Rice novels, I studied the remaining items of literature. There was those Lord of the Rings books.....but I didnt feel like undertaking such a mighty task at the moment...heh I guess I really was too lazy. ^-^() Sifting through the other titles I started to notice a trend. Wow, look at all these Bond novels... I had wanted to read one before but right now Bond just didnt fit my mood. And then I saw the title of one of my books: The Collected works of Edgar Allen Poe. Without really thinking I took it out and started to page through it. Yeah, why not. For some reason it seemed like a good choice, and it would keep my mind occupied. I changed out of my labcoat into some comfortable pajamis and curled up in Davids big leather chair, and started to read.
~~~~~~
....than I was answered by a voice from within the tomb! - by a
cry, at first muffled and broken, like the sobbing of a child, and
then quickly swelling into one long, loud, and continuous scream,
utterly anomalous and inhuman - a howl - a wailing shriek, half of
horror and half of triumph, such as might have arisen only out of
hell, conjointly from the throats of the dammed in their agony and of
the demons that exult in the damnation.

The Black Cat. A creepy story of a man driven by rage to kill an innocent animal, and its revenge upon him. It was just a story however, nothing that could really scare me.....except for what seemed like the book coming to life.
“Rrrraaaaowww?!?!?”
I jumped, losing my place as I dropped the book, and shot a glance at the curtained windows. Am I imagining...? I started to think but then a second meow followed the first one. No, there was a cat out there! How strange....David and I lived in a penthouse near the top of our building. To think a cat would come all the way up here....?
Maybe the cat had climbed the tree next to the building and jumped to the ledge of our window, perhaps chasing a bird, and got stuck. Well, however it got there, I couldnt just leave it there. Quickly checking the time I saw that it was 4:23PM, still too early to safely open the curtains. But its plainative mewing I couldnt ignore, so I set about figuring out a way to let it in without roasting me alive. Feeling through the curtain for the latch of the window, I unhitched it and let it swing out, hopefully NOT knocking the cat off the ledge. Then I wrapped myself slightly in the curtain, creating an opening for the cat to come in. Now I just hoped it would hurry up....
Soon a slight patter told me it had come inside. I carefully replaced the curtain, but I would have to wait until dark to shut the window again. Oh well, it wouldnt do any harm to leave it open.
Taking my first look at the cat I saw (to my relief) that it WASNT a black cat, but was pure white, with crystal like blue eyes. After getting it a saucer of milk, I watched it lap it up and then look at me with a questioning gaze. “Mmmmrraow?” It seemed to ask. I smiled. David always liked cats, I think this one would be a nice surprise for him, andit would be nice to have an animal around the house. “Well, Kitty, how would you like to stay?” I asked, amused. It rubbed against my legs and purred. I laughed slightly. “Ok then, how about I call you Snowball?” Purring some more I picked it up and hugged it. Suddenly something was wrong.
I felt the hunger for blood rising up in me. But this wasnt right. I usually didnt need to feed until I was already at work, sometime during the night. Putting down Snowball I went to my purse and pulled out the blood pack. Quickly opening it up I drained it, then realising I wanted more. After going to a small hidden compartment in the freezer and getting out more I found that nothing was working. The hunger remained and was stronger than ever. The cold blood wasnt satisfying it, like I needed it...fresh. NO! I thought to myself. I cant!! Looking at the cat I felt the urge to take it in my hands, to spill its fresh warm blood and drink my fill....I COULDNT! Jerking my gaze away from it I staggered painfully to our room, and shut the door. My joints were burning, I felt indescribably thirsty, like I was dying all over again. I felt like the man in Poes book, who had a gentle disposition until everything changed for the worst and he found himself thinking things that horrified him. It made my heart jump in fright to think of what might happen if David found me like this.

As much as I wanted David to be safe, I hoped he would not come home.

Because home wasnt safe as long as I was here...
~~~~~~~~~~~~~~~~~~~~

Ok ^-^ Im setting things up for night to fall, with permission from Gav, so the vamps can do more lol
EDIT: Just adding a few things plus bibliography ^-~
From Julius Caesar, by Shakespeare
From 'The Black Cat' By Edgar Allen Poe

[Kuro Espeon]

Errr...is any one gonna post here? I'm kinda waiting on U_C to post....

[Ultimate Charizard]

Keruga'Vyorn
------------------

"My plan is exactly as it sounds.....MY plan" I snapped. "we may not be enemies but i prefer to work alone.
I turned to walk off and she followed. "What you do is your decision, personally i plan on finding out what is going on around here"
I headed back to the main area of the hospital as she ranted at me for being so 'selfish' as she said it.
I went back to the changing room and clocked out. Once done i headed home, Roku was nowhere in sight although her scent lingered.

She didnt concern me right now however. Right now i needed to prepare. Tonight i would be back at the hospital. I would be waiting when that Vampire showed up.

[Master Rudy]

Since Gav had no problem with it I'm going to go ahead and move on to the night. Credit for some of the lines and ideas in this post go out to Dru who had written the original ^_~

David Summers
------
Despite my earlier fears from this morning I felt fine as I left work that night and was making my way to my car. While I still had Siv's prediction on my mind I just tended to ignore it. Even so I was kinda wishing I didn't park in a dark and slightly remote part of the parking garage. However I wasn't going to get myself worked up and worried. The sun hadn't even been down for 20 minutes. It was only a simple matter of getting to my car, driving home and then getting inside of my apartment to spend a night with Brandy. After all the recent events I couldn't ignore Siv's warning and pass it off as a money making scheme. I had quickly accepted my fate. Even so I was feeling pretty good about tonight. It just didn't seem as if it was my time to die yet.

If only I knew how wrong I was.

As I stepped onto the roof of the garage I saw my car on the other side. Normally I would not have parked up here but I didn't have much choice in the matter. The lower levels had filled up quickly and forced me to come all the way up here. It wasn't that big of a deal to me. The only problem was the fact that the roof was not lit up as well as the lower levels. Soon however I'd be at home. After all what could go wrong in a period of 30 seconds that involved me walking to my car?

I was about to learn my lesson the hard way.

Just as I was getting near my car a sudden female voice startled me. "It's rather dark to be walking alone don't you think?" All I could do was freeze in my tracks. Not sure what to expect I slowly turned around only to see no one was there. Normally I would have calmed down as soon as I thought my mind was playing tricks. However soon the voice said something else and this time it came from right behind me in the form of a whisper. "You seem tense but there's no reason for it. Don't be afraid." Once again turning around I saw myself face to face with a girl who appeared to be in her late teens. While she didn't seem to be the type that would be violent I had a feeling that I knew what I was in store for. Right now I was unsure of how to react. I tried to speak to her but the only thing that came out were the words "Leave me alone." As much as I wanted to do more I couldn't. I was honestly too scared to fight back. All the girl did was laugh a little bit before forcing my back against the car. The only thing she said as she wrapped her arms around my neck was "Come on dear. This won't take too long." Suddenly she leaned in and kissed me. To the mind of any other man she would have seemed to be nothing more than a hooker hoping to make some quick money. However my instincts were telling me otherwise. I knew I was in trouble and as a result my fear was no longer holding me back. I tried to get her off of me with all my strength but she proved to be much stronger. Soon I felt the tips of fangs brush against my lower lip as she pulled away a bit. I hadn't seen her face since she kissed me but now there was no need. I knew what she truely was. Panic once again rose up in me as she once again whispered in my ear. "You are a fiesty one. I like that. Now come on......come to death. It isn't that bad. Trust me....."

Before I could even react the girl had bitten into my neck and was draining my blood. Despite the major pain I was in I didn't cry out in pain. I knew I was going to die and become a vampire now. The least I could do was not allow her the pleasure of hearing me yell. However just as quickly as she had started she stopped. Soon it was followed by a yell. "What the hell are you doing?!" The only thing the girl did was drop me to the ground and run. Getting up I saw what had startled her. One of the security guards that was assigned to the garage was making his rounds and spotted her. Soon after that he started to chase her as she ran away. I didn't say a word as he ran by since I already knew there was going to be no way in hell he caught her. Even if he did I had a feeling he'd only take my place instead. Rather than stick around to see the outcome however I reached into my pocket and got my car keys. I was getting the hell out of here......

******
15 minutes later
******
As I opened the door to my apartment I couldn't help but feel a bit shaken over my near death experience. I was still rather surprised that I'd live to see another day but now my main question was how much longer did I have until the prediction really did come true? Rather than dwell on it all I did was reach out for the bedroom door. After all that I wanted to get a little rest. However to my surprise I found the door locked. That's strange I thought to myself. Why would Brandy lock the door? Now even thinking of what the reason may have been I unlocked it with my key. Inside I saw Brandy who appeared to be sleeping on our bed. The thing was that something didn't seem right. A low moan came from her suggesting she was in some kind of pain. Nearby was an empty pack of blood she had taken from the hospital. As she slowly opened her eyes and saw me she started to speak. That was when I noticed the third thing that appeared to be wrong. Brandy appeared to be in her human form but I could see her fangs as if she was in her true vampiric form. It was as if she was having trouble holding her human form. "David......you can't be here. It's too dangerous for you." While I was worried about Brandy I did make a comment about what happened. "It can't be as dangerous as out there. I got bitten by a vampire but lucky for me....." A look of shock and worry soon appeared on her face stopping me before I could finish. For a few moments she was quite as she studied the bite which she was seeing for the first time. Soon after that tears started to roll down her face. It didn't take her long to explain why she was upset. "David.....I don't know how to tell you this but I've got no choice. One bite is all it takes to get turned into a vampire. Getting away doesn't help. At the most you've only got a few hours left as a human. Soon your going to die only to be reborn as one of us."

The truth had hit me like a ton of bricks. As if it was on cue I was suddenly not feeling very well. She didn't have to say another word about what was going to happen to me. I already knew it was starting. However she wasn't done talking yet. Now she was about to explain why she wasn't feeling so well. "I'm also dying David. However unlike you it's going to be for good this time. I don't know why but it's as if my body needs something fresh now. I don't think I can last past the morning." Hearing this come from Brandy made me forget all about what was happening to me now. My surprise over myself was due to the fact that I didn't think one bite would be enough to kill a person. As for Brandy it was too much for me. There was no way I was going to watch her die as I slowly turned into a vampire myself. I knew what had to be done.

Before she could even ask what I was doing I had sat down next to her on the bed and pulled her close to my own body while making sure her mouth was near my neck. With a very serious tone I said "The last thing I'm going to do is let you die on me. If your needing fresh blood then you might as well take it from me." She may have been weak but Brandy was trying to push me away as I held her. "I could never do that to you David!" she said in as loud of a voice as she could manage. "I can't kill you!" As serious as everything was I did laugh a little bit while I spoke. "You said it yourself Brandy. I'm going to die and turn into a vampire anyway. You might as well just speed it up and get what you need before it's too late. I'm willing to live like this under one condition. We live like this together now. I'm not kidding you when I say I'm going to go get a serious tan if you wind up dying on me." I was trying to hold it together but I too was crying now. However it wasn't over the fact that I was going to die. To me that was the least important thing now. I was more afraid over losing my wife than anything else. Brandy was no longer fighting me and seemed to be thinking about doing it. I wouldn't force her to do this if she didn't want to but I did hope she would. It was all up to her now......
------
To tell the truth I perfered Dru's version of her attack on David. However it had to be changed when I found out that just the bite alone was all it took to turn a human into a vampire. I still would like to give her major credit for coming up with the original post for it ^_~

[Kuro Espeon]

GoldenNoctowl77: Hey...who the hell ARE you anyway?! Be GONE spammer!!! *holds up fingers in a cross formation*
Back! Back! Away evil demon! *Takes out whip and snaps it* Back Simba!

This post'll be rather short, I'm low on the creative juices at the moment.

Roku Veradim:
~~~~~~~~~
I fumed as I walked away from the hospital. Who did that Feran demon think he was? Despite what he may think, he is not high and mighty and all powerful! He thought himself above all help, and it was demons like that that pissed me off. So he said he didn't want my help? He prefered to work alone? Very well, then he would! He would be on his own.
But that didn't mean I still wasn't going back to investigate for myself. It was my sworn duty to destroy evil and in order to do that I had to follow every lead I was given. But...if that Feran got himself in trouble...it would be HIS trouble. He wouldn't get one ounce of my assistance, though I seriously doubted he would ask for it.

It wasn't long after that that the sun set below the horizon and the city ws once again swallowed by the shadows of night. I stretched out my wings gratefully, giving them several beats, stirring up the dead leaves on the ground around me. I much prefered having them out to keeping them hidden and cramped. I normally slept during the day so I wouldn't have to put up with it.
I brushed my two strands of red hair back from face, tucking them behind my pointed ears. I looked up at the clear night sky, at the millions of glittering stars and the infinate black velvet expanse of space. I sighed.
"Well, well...it's full moon tonight." I smiled lightly. I always enjoyed the moon...
Flexing my wings and claws dangerously, I set off towards the hospital...Keruga should be there by now... I was curious to see what progress he had made.

[Outlaw JT]

Ashram Marduk {Hammurabi to the eldest of vampires(eldest being older than 2000)}
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

It had been a dull and boring day. He had met with the so called administrators of the city. To him, they were mere puppets; pawns upon a chessboard. Tonight he must find something more to amuse him till his hunters found their assigned prey. until they brought the one before him he had little else of consequence to occupy him.
"What is this?" he said with a twinge of interest as he read the report that had been prepared to him from the days events.
As he read on it appeared that his newly placed representative at County had found a most unusual vampire. One that apparently did its best to avoid their lifestyle. One that obviously chose to shun their races existance rather than embracing it. Meeting such a vampire could prove an entertaining distraction.
"I must pay a personal visit to a most peculiar doctor. If anything pressing arises forward one of my hunters with the message. They will be able to find me," Ashram said as the smile slightly grew on his face.
He set his report down and quickly set off into the tunnels below the city. It did not take him long to know where he was headed. Ashram had long ago memorized the tunnel system below Pernicious so that he knew every exit or entrance to the surface world. in only 10 minutes he had found the exit he was looking for. One that led to the basement of a quaint apartment building.
With swift ease he floated up the stairwell of the building, doors opening for him several feet before he was in reach of them. He was in a rather mischievous mood now and everything should be as dramatic as could be managed. Consulting the image in his mind of the address listed he exited onto the proper floor. In seconds he was standing outside the door of the apartment of one Brandy Summers.
As he reached it he paused. He could hear a very personal conversation unfolding within and his smile deepend with the sense of irony that washed over him from its details. So now this reluctant vampire was left with little choice but to embrace her nature and she found her husband to be both victim and sacrifice. It was too much to have asked for. Any vampire so quick to deny their nature deserved such morose circumstances as had seemingly befallen this one. Her education would not end there though. Not tonight. Tonight, Ashram himself would instruct her on what it meant to be a vampire!
Without another moments hesitation he stepped forward and walked through the front wall of their apartment as easily as if it had been air. At the sound of the wall being torn asunder a young man stepped out from the next door suddenly. With apprehension in his eyes he looked to the hole in his wall and then at Ashram. A younger woman appeared behind this man. This must be the one he had come to see.
"Ah......what a lovely couple the pair of you make," Ashram said warmly as his smile broadened.
The warmth of his greeting nor his smile put them at ease though. There was a darkness about Ashram that could not be defined. His smile seemed vicious and forboding. The man quickly spread his arms out to shield the woman.
"What a noble yet completely useless gesture young man," Ashram started, his voice still warm and very amused. "You must realize that even now, weakened by hunger, Brandy is still much stronger than you David."
"Who are you?" David shouted. "And why have you broken into our home?"
"I am Lord Marduk. I rule over all who would call this city home!" the warmth had now evaporated from Ashram's voice. "And I have come to educate your pale bride on what it means to be vampire!"
"No!" the woman shouted and she rushed forward from behind her husband.
No sooner had she gotten past her husband though then she realized Ashram was no longer in front of them. He was now standing behind David, but she had no time to warn him. Ashram moved with so much speed that even she could hardly detect him. David had no chance.
With a swift motion Ashram grabbed David about the neck with one hand and turned him face to face while lifting him into the air. Ashram then sprang forward to slam his back into a wall. He held David there, struggling feebly to get away. He turned to Brandy with a cold smile.
"No good ever came from denying who you are! Failing to embrace your true nature can only bring death and destruction to yourself and those around you! You will learn what it means to be a vampire or those you love will be made to suffer!" Ashram hissed sharply.
"Let him go," Brandy shouted indignantly taking a step forward to try and free her husband.
Again Ashram proved much to fast. As she reached for David he was no longer there. She turned to find him still in Ashram's clutches at the window. She moved towards them again but this time Ashrams actions made her freeze in place, her heart caught up in her throat.
With what seemed all his might Ashram threw Rudy upwards through the window, glass shattering every. His form disappeared up into the night. For a moment it seemed he had disappeared completely but his existance was confirmed by a loud thud somewhere off in the distance. brandy leapt forward to go after him but Ashram caught her throat in midair, her body lurching forward as her head hangs in Ashram's grip.
"If you really must see him, allow me!" Ahsram barked and he threw her into the night as well.
He leapt forward out of the window with great speed after them. With untold swiftness he managed to land at the same time as Brandy on the roof of the building across the street.
Brandy got up quickly but she was still a bit dazed. Ashram got to David much more quickly. He wrapped his long fingers around the mans throat but did not clench them. He held them just tight enough to maintain his hold, not pressing in enough to do any damage.
Brandy continued moving towards them, regaining her balance quickly but Ashram held up a hand to stop her.
"In a few hours he will not feel a thing from his current breaks and bruises. One of two things will happen. Either you will go out into the night and feed as is the nature of what you are. You will drink enough blood to regain all your strength and you will return. Either this will happen, or I will spare your husband David from the life which you have rejected," Ashram spoke evenly with a firm tone.
His voice made most clear that he was not speaking in jest. Either she must feed as a vampire or her husband would be no more. She hesitated, debating what she could do.
"I give you till one hour before sunrise. That will give you time enough to restore your strength ten times over," Ashram said a bit of the warmth returning to his tone, although it did not improve the situation for anyone.


OOC: just a reminder before anyone responds to this post. Ashram is the main villain of the rpg. He was bound to act like it eventually.

[Bulbasaur4]

Martye Coia tel'tehtar a.k.a Tella Me'arauko (F - Light Demon, currently in albino cat form)
***


Poor children... they must be so confused.
Thought Tella, shaking her head in her albino-cat form, as she watched as David entered the room. They had not noticed, or David rather, as the swift and light-footed cat figure had gently walked with him, entering the room. She watched their intimate moment with out shame, knowing full well that they loved each other and felt no guilt for it - so thus she felt as if it wasn't a bother to watch. To them after all, she was just a cat. Not even the ancient of vampires would probably be able to sense her Light Demonic aura... especially in a transformed state.
So, they needed and were craving blood... at least, Brandy was.
Poor child... she must suffer so much, and soon he will too. I can help them however... I can aide them and make it so they will not hunger as much as most vampires... I shall do that too, as soon as they are asleep.
Tella thought, nodding her head as if having her mind set on that course of action.

Then, suddenly Tella's ears flattened against her head as she sensed a horrible, thick presense with in the air... her icy blue eyes were wide, and she let loose a very very loud yowl. David jumped up, his eyes gazing at Tella (whom she took the name' snowbell' unknowing why she would be named such an odd name), and then suddenly a hole inthe door insued.

Indeed, it was an Ancient Vampire whom Tella faintly remembered..Ashram.. that was what she thought his name was, . but she could tell he was of ancient proportions- his dark aura was thick and wide, swirling in the air and she could see it clearly with her own eyes.

She watched, as this vampire quickly moved and grabbed at David, and soon she watched as David was flung out the window, and soon Brandy came forth. Anger rose with in Tella, as she heard Ashram proclaim about how the vampires ruled the city... it brought back memories of the war long ago which caused her race's extinction.

As soon as Ashram also leapt out of the window, Tella immediatly used her swift and demon-enhanced body, to leap on the shattered edge of the window, and she gazed across to the other roof of the building that they were upon. Ashram was much to powerful and quick for Brandy, as he held David by the throat. Narrowing her eyes in her cat-form, she quickly leapt across as well, and landed promptly upon her feet next to Brandy. It didn't hurt one bit of course- she was demonic, and she was a cat... both of those sides did not feel much from even incredibly high leaps or landings.

She felt Ashram's gaze flicker onto her- probably surprised at a cat falling from the Building, as Brandy jumped slightly. But of course... her attention was not long, for Brandy now had to make a deathly decision. Tella waited... knowing full well that Brandy would do this for her love - for she did not want him to die.

Tella's question was, she wanted to stay with this vampire couple. They were the only vampires whom she thought had worthy compasion... the only vampirs would perhaps could have made a difference during the Light vs Dark wars... if only they had been born sooner. Which one to stay with however? David? Or Brandy?

The female... she would be better to help, if she raninto trouble
Thought Tella, and it was confirmed. This way, if Ashram was bored... he wouldn't accidentaly feel the light demonic presense in her small aura she gave off.. if vampires could even sense 'auras' like Light Demons could. Tella waited next to Brandy... ready to move when she did and follow the poor child.

[Asilynne]

~~Brandy Summers~~
How BitterSweet is Deaths embrace...
:::6:38PM:::

My tears of pain and sadness splashed down upon Davids still-warm neck as he held my dying body to him. What he asked was next to impossible for me----and yet at the same time my body desired to fufill his request, it hungered for the blood that corsed through his veins at an incredible speed, it wanted, NEEDED to hear his pounding heart slow and stop as the lifegiving fluid it pumped flowed into me instead. But such thoughts burned my mind, they were more painful than this feeling of dying. To think of taking any life let alone my husbands, the man I swore Id love for eternity, was like a stab in my undead heart. I....I couldnt do it. I wouldnt.....I........

Even as I thought these things I knew----either we would both live as vampires, or we would both die. In order to save Davids life and my own, I would have to kill him. I was in a nightmare, an endless circle of cause and effect with only one thing for certain:

Before sunrise the next day David would be dead.

Lacking the strength of mind or body to resist anymore, my clenched jaw relaxed. I could feel myself getting weaker, I was no longer able to hold myself up. If it werent for Davids strong embrace, and his warm hand holding my face against his neck, it would have been too late for me to feed. And a part of me knew that David, too, was running out of time. Though he was still warm with human life I knew soon that warmth would cool, and it would be too late for his blood to save my life. As if hearing my thoughts David held me tighter. "Please Brandy...before its too late for both of us..."
Hearing this was the final push. I couldnt ignore the desperation in Davids voice, and I couldnt ignore the warm pulse of his blood. So, tears streaming down my face, I shut my eyes and opened my mouth. For the second time that day my mouth closed on Davids neck, only this time there would be no joking around.
Slowly I let my fangs sink into his skin, applying just enough pressure to pierce it enough for the blood to flow. Other than the rhythem of his breathing changing slightly, David didnt make a sound as I started to drink his blood. I could feel my strength returning, but at the same time I felt Davids body relax as his strength began to leave him. But at that moment everything went to hell.

The sound of our front door being bashed in caused me to stop feeding, and both me and David turned our eyes to our bedroom door. Without saying a word we each got up as quickly as we both could under the circumstances and went to see what had happened. As if this night couldnt get any worse it was another vampire, though this one was far more powerful than I ever would be, or cared to be for that matter. But it was my refusal to embrace the vampire lifestyle that 'Ashram' had come seeking to change. Using David as leverage, he took our little scuffle outside the hard way, and then made me an offer I could not refuse....

Either go out into the night and feed from the human population, or David would die.
~~~~~~~~~~~~~~~~~
This post will be in two parts, this is part one ^-^()
EDIT: Adding a few things ^-~

[Asilynne]

~~Brandy Summers~~
Is love worth killing for, or dying for...?
:::6:46PM:::

”No good ever came from denying what you are!”

I clenched my fists as the words this ‘Vampire Lord’ had spoken echoed once again in my mind. It angered me that he wanted to change me from who I was, that he wanted me to become a murderer, to lose any shred of humanity I so longed to hold on to. It angered me that he held my dying husband aloft, that he was using Davids fading life to force me to end someone elses. And it angered me that no matter what I did, I would be committing a great sin, and I would be causing more suffering before this night was through.

That creature was no lord of mine.

I stood immoble, staring at the vampire holding David captive for what seemed like forever. Thoughts flashed through my head, possible outcomes of the descisions I might make.
I didnt want to leave David there.
I didnt want to kill.
I didnt want to die.
I didnt want David to die.
My anger mixed with a feeling of despair, but I willed my tears to stay away. I knew that, to make it through this night with David alive, I would have to be strong. With a steady gaze I reguarded the vampire, and proceeded to let him know he wasnt going to be fully in charge of the situation.
“If I dont feed, your going to kill him.” He grinned, an evil twinkle in his eye. “Thats right, now your getting it little one. Perhaps now you see----”
“But if I dont feed, I will die too. Either way we ll be together.” I kept my gaze level, showing him I meant what I said. Both of us dying wasnt something I wanted, but I wanted him to know that it wasnt something Id rule out if he pushed me that far. I wanted him to know that I was something not easily controlled.
The vampire lowered his arm until Davids feet could touch the ground. “And you would really watch your husband die, all to protect your bloodless record? You should know I have ways of...’convincing’ you to embrace your destiny, after this young man has met an unfortunate end, so such a thing wouldnt be in your best interest.” His grin got bigger and I began to feel sick with fear for Davids life. “Your darling David would die for nothing...”

I saw David turn his eyes to me, an expression of sadness and fear shining in his warm hazel eyes. After what the vampire had said I had made up my mind, and Davids face had reinforced that descision. Letting out a shuddering sigh I closed my eyes and looked down. “Well then, I dont seem to have a choice then, do I...” I said, in a slightly choked up quiet voice. After a moment I looked up again, with a determined look on my face. “But I wont leave David unless you let me talk to him for a moment.”
Ashram looked amused, and adjusted his hold on Davids neck so that he was facing forward towards me. “Talk.” he said, that glint still in those eyes I was learning quickly to hate.
Coming as close to David as Ashram would allow, I looked into his eyes. There was no fear now, just a sense of pain and frustration. “Brandy...”
I knew what he was going to say. He was going to say I shouldnt feed, I shouldnt kill anyone, and I shouldnt even bite them because even the tiniest bit of blood extracted would change them into one of us. He was going to tell me that I shouldnt cause anyone else suffering just for his sake, that I should resist, fight this vampires will even if it meant he had to die.
Well, sorry David, thats not acceptable to me...

“I ll be back, David.” I said, with a mix of sorrow and determination in my voice. I reached up a hand to touch his face but drew it away as Ashrams hand tightened slightly on Davids neck. I took a deep breath and tried not to look ruffled. “I love you.”

I turned away and started walking before I could see the pain in Davids eyes at what I was about to do. I didnt want to kill, I didnt want to become something inhuman. But I didnt want my husband to die. And that outweighed everything.
Suddenly a ‘mmmrrrraoooww’ rang out beside me. Looking down, I saw Snowball had followed me. As I scooped up the cat, some tears managed to spill out from my falsely stern eyes. “Oh Snowball....what am I going to do...if I feed David and I will both live, but at what cost? Selling my soul to the devil...but I HAVE to do it! I wont let him die because of my inaction....”
There are more ways than one.
A warm voice came out of nowhere, speaking these words of comfort. The despair I felt evaporated, and was replaced by a feeling of hope. Maybe there WAS another way, a way to gain back my strength with fresh blood without having to kill anyone. And then it hit me.
“Brandy, if you ever need anything, you can always come home.”
My mother, though not by birth, had always loved me like I was her own. She fed me from herself when I was first turned, gave me the gift of her blood so I wouldnt die, though it weakened her. Though it hurt me to think I might need to take from her again, I knew she would understand. She always understood.
I stood up, and started walking down a familiar street I hadnt been on for many years.

“Mother.....Im coming home...”
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Whew ^-^ Part two is now complete! I have a plan that Ill tell everyone involved next time I see you all on MSN, pretty short but I want it to be a surprise for everyone else mwahahahaha!

[Asilynne]

Ok, I threw away my original plan in this so that we could get JTs character in, so someone post dammit!!! I like this RPG and I will NOT let it die!:mad: :mad:

[Drusilla]

Eep! I'm back, ya, but I've got a lot to catch up on and I'm taking almost all AP classes this year, meaning I've got a $*@! load of homework, and I can only get online at school... soo, gimme awhile to catch up again ^_^;

[Asilynne]

WB Dru! ^-^ Once you catch up, feel free to interact with Brandy and thicken the plot a bit. Lets give this thing its second wind lol

[Drusilla]

~*~Drusilla~*~
David Summers... he was married to Brandy. I knew Brandy... we went a few years back. I grinned to myself as I sat on the ledge above the open window. So intresting...
The cat intrested me too, but I could not tell why. It was more than a cat, I was sure, but as long as it was a cat I didn't see how it could be a threat to me.
Ashram was rather ruthless. My grin grew broader. I served him currently, at a very high price. There was some special half-demon that he wanted. A female, half human, and half shadow demon. Very intresting.
Brandy was going to feed. She had a plan, I could tell by how she held herself as she walked down the sidewalk below and out of sight. Ashram had David... which one to follow? I laughed silently. I haven't had this much fun in years...
My dark blonde hair blew in the wind, brushing against my cheek. My very pale cheek. I hadn't gotten much blood... the guard was in pretty poor condition. He tasted of stale beer... among other things. Disgusting.
I went in search of prey. I lept from building to building, as I usually did. And then, I saw her.
She was wearing all black, and looked incapable of taking care of herself. But I could tell that she could. She was a fighter, and not at all what she seemed. She was the girl that I had seen the other night. I decended to the street, several yards behind her. I didn't want to get too close. Never frighten someone who wasn't all human.
She heard me, I knew. "Nice evening, isn't it?" I asked.
She turned and looked at me, ready to fight. I laughed. "I'm not after you girl, not now. Well, I suppose I am, but I'm not going to do anything about it at the moment. I'm... curious more than anything. I suppose I can't prove it, so you'll just have to take my word. No, not as a vampire, but as another woman."
~*~

[Asilynne]

Well here it is, I had a plan in this RPG and then JT comes along getting his villian character INTO my home, tossing my husband out the window, holds him hostage with no choice but to wander about, and then he leaves and never posts. What the hell?! Well Im not going to let that ruin ANOTHER RPG, I LOVE this RPG, so heres how it stands-
Someone can make a post within the next 2 days or I will post again: and I can promise if that happens JT is NOT going to like it.

[Bulbasaur4]

I will probably post later... but just to let you know..

I think your last post was very rude, Asi. You do not know the circumstances... and it isn't like we've seen JT online and he hasn't post. OBVIOUSLY some thing has happened... wouldn't you feel horibble if some thing bad happened to him and you were blaming him and acting rather rude?

I took extreme offense to your last comment... you don't have to be so mean in your posts.
:(

[Bulbasaur4]

I will probably post later... but just to let you know..

I think your last post was very rude, Asi. You do not know the circumstances... and it isn't like we've seen JT online and he hasn't post. OBVIOUSLY some thing has happened... wouldn't you feel horibble if some thing bad happened to him and you were blaming him and acting rather rude?

I took extreme offense to your last comment... you don't have to be so mean in your posts.
:(

[Kuro Espeon]

...I really don't think Asi was trying to offend anyone Bulbie...try not to be upset... I'm sure she's sorry, right Asi?
Well...enough of that. Remember B4 that none of really know what's going on with JT. One of us should probably e-mail him (preferable someone who knows him better than I do) and find out what's happenin'. None of us should make any accusations until then.

Anyway....I've really been wanting to post....but...I found myself extremely lost an unable to pinpoint were my character could come back in. If anyone has any suggestions I'd love to hear them.

[Asilynne]

Looking back over what I had written, I realised that it came out a lot meaner than I meant it to, and Im sorry about how heartless I may have sounded, however:
Last time I had seen JT online, I had asked him about when he was going to post in Dream, and by the way he was talking he acted like he couldnt care less that he was holding up me and Rudys characters. But since I dont like going 'POST NOW POST NOW POST NOW!~' I just let it go and sat back and waited for him to post in at least ONE of the RPGs we were waiting on him in. But then he disappears, leaving no trace of where he is or when hes coming back.
Now I know I dont know whats going on with JTs home life, but you sound like you might know something, Bulbie. We dont need to know every detail but if you know something at least tell us not to wait up on JT, and if you dont then, please find out for us? If anyone can get in touch with JT and dispel the mystery of where the heck he is, its you. Your the only one that can reach him offline.
I didnt intend it be cruel in any way, Im just a little frustrated that my characters in 3 RPGs have been pretty much stalemated by JTs inactivity. Hopefully it ISNT anything serious.

[Asilynne]

Well, since my character IS a doctor, who better than me to bring this to life? ^v~ *puts on gloves and gets one of those, electric things lol* CLEAR! *BUMMPFFFH*

~~Brandy Summers~~
Home is where the Heart is...
:::6:45PM:::

“Mom...Im home...”

A hundred thousand memories, of all the sounds, smells and sights of home from days past, flooded my senses as I opened the front door of the place I never thought Id set foot in again. Everything was just like I remembered, from the potted flowers hanging on the porch, the wind chime on the balcony, and the key under the welcome mat. I had always thought leaving a key somewhere outside, no matter how well hidden, was a dumb thing to do.

Until now.

“Brandy?!” My mothers voice rang out, as she rushed into the hall and gave me a hug. “Oh my god! My baby! Whats the matter, you look like youve been through hell!” Having my mom here again, comforting me, made my reason for being here come back in full force, and I lost it. Tears flowed freely from my eyes as I told her everything that had happened, from my burning aching thirst, to David being bitten, and finally to the Vampire ‘Lord’ who had David captive and had given me the ultamatum---feed from the population, or David would die.
My mom listened to the whole story as I sobbed it out, not saying a word until I was done. “Its horrible Mom...” I said shakily, wiping the tears from my eyes as I tried to compose myself. “Whatll I do? I cant kill anyone, but I cant let David die! He means everything to me...and I feel bad coming here, I know it makes you weak..Im sorry Mom...I dont know any other way...” As I finished I almost broke down again, but my mother put her hand on my shoulder and spoke. “I know, I wouldnt want for you to kill anyone, we raised you like a good christian girl. Its alright, your always at home here Brandy..”
I couldnt watch as my mom cut herself and let her blood flow into a glass. I didnt look at it as I put it to my lips and drank. I couldnt look into her eyes as I finished, knowing that, though she had given me as much as she could, it still wasnt enough.
I needed more.

Just then a chill ran down my back. Something was wrong, very wrong. “Mom I have to go...!” I said hurridly, setting down the glass and moving towards the door as quick as I could. “Brandy, wait!” she said weakly, trying to move to stop me but unable to do more than stand in my way. Frustrated I shook my head. “You dont understand Mom! Me being here is putting you in dang----”

Suddenly the windows exploded inward, as something crashed though and landed with a thud on the floor of the living room. Startled, I shielded my mom from the glass, and then got a good look at my ‘attacker’.

It was David.

Letting out a scream of anguish and fear for Davids life, I ran to him, and lifted his head in my hands. “DAVID!!” I shrieked his name and patted his face. He cant be dead! NO this isnt happening! David...Please dont be dead! I couldnt imagine life without David, although being a vampire I was technically already ‘dead’. He gave my life meaning, he showed me that even living in darkness I could still see the sun. David was the sun for me. I could not go back to living in the darkness without him.
Then his eyes opened, and focused unsteadily on me. “....Brandy..?” he gasped, and for a brief moment, I laughed in relief. His heart was still beating too, but upon closer look I saw it wouldnt be for long.
The change was already beginning.
His usual warm, hazel eyes were now a luminescent blue, and his hair was changing to an almost white platinum blond. The canines which would be fangs on a vampire were slightly pointed, though they were still human sized. The change had started, but was still incomplete.
I might still have a chance to save him from my fate.. I thought to myself with a surge of hope, though I didnt know how I would do so. I clutched David to me protectively as he struggled to move his aching body. “Shh...dont try to talk David, just try to hold on...” I whispered, but then I realised things werent over.
They were just beginning.
“You dont get it, do you.” I heard a voice that chilled me to my soul, a voice that sounded like the toll of a church bell on the day of a funeral. It was the Vampire Lord Ashram, and he was in my moms house.

And he had my mom.

“I told you, to go out and feed like a Vampire. Running off to your human mothers house and ASKING her for her blood is NOT what I MEANT!” Ashrams false warmth seemed to be falling away as he held my mother aloft. “No...” I choked out as his fingers began closing around her throat. “Your husband is dying, Brandy Summers, and yet you wont even do the simple task of embracing your kind so that he may live with you as a vampire. Youve been a bad little girl,” he smiled warmly once again, a smile like a picture fireplace with the light of warmth but no heat. “And so, you must be punished.”
With a swift movement he thrust her head back, exposing her throat, and then sank his fangs in and began to drink. Standing up quickly as David managed to sit up, I started to run to the aid of my mother, but something held me back. Ashram wasnt letting me near, and with a gesture of his hand I was thrown back through the wall of the living room. As I fought my way out of the drywall and plaster, I heard the sound of a body hitting the floor. “NOOO!” I ran forward, this time unhindered by Ashrams will, and stopped short as I saw her laying there.
I was in shock. My brain refused to understand what I was seeing, my mind wouldnt comprehend this sight before my eyes.
She.....was gone....
“This is who you are, Brandy. This is what it means to be a vampire.” Ashram said, placing a hand on my shoulder. “You cant run from yourself forever, and now David must learn as well. You both will learn, or more humans, more ‘innocents’ as you foolishly think of them as, will die. Its who you are......”
I felt as though I was in a dream, like none of this was really happening. I felt as if I were watching myself standing there, like it was just something I was seeing on TV. I felt as though maybe....maybe what he said....was the truth......and this really was who I was..........

.........Was I always a Vampire....? ........Was my time as a human.....merely the dream........and this was how things were......? Was the person I am......really..as he said.....?

Suddenly the torrent of thoughts and images swirling through my head cleared away as Ashram was taken off balance. David had gotten up and, though I knew he mustve been in a ton of pain, he jumped Ashram from behind. I knew he didnt have a chance, he was weakened already by the pain of dying and Ashram was hundreds of years old, but he tried anyway, to shake me out of what I now knew to have been Ashrams mind control. “You fool! What do you hope to accomplish!!!” Ashram yelled as he reached behind him to grab David and toss him through yet another window. “David!” I yelled and then turned my angry gaze towards Ashram. “You BASTARD! LEAVE US ALONE!” I screamed as I rushed at him, now fully in my vampire form but not caring in the least. Before I could get to him and without even touching me he hurled me through the drywall, wood and then the brick of my moms house.
I lay there for a moment, feeling liquid gushing from me, and realising I was bleeding, but all I could do was try to catch my breath. I heard David gasping in pain beside me as he placed his hand on my cheek. “Are..you ok?” he said, his own eyes reflecting both the pain he was in and the pain he saw in me. I nodded as he helped me up, and for a moment we just sat there, glad that, for this moment at least, we were both alive and together.

“Your still children, I suppose...” It was that voice again, Ashram still wasnt finished with us. Though I couldnt see him anywhere, I knew he could see us, but I refused to give the appearance of being scared. Although I knew David could feel me shaking, and I could hear his still beating heart, beating faster now and sounding dangerously close to giving out. The voice continued. “I have plans for you, little ones, and I still think you can be taught. This night is just beginning, and if you havent learned the lesson before its over then you shall be watching the sun rise together, and doesnt that sound romantic?” Ashram laughed and then he spoke no more.

Still shaking a bit, there was only one thing on my mind. “Come on David, we have to get you to the hospital. I..I cant just sit by and watch you die! I HAVE to try to stop it!” David nodded and began to slip out of consiousness again. Picking him up gently, not caring that I was still in my vampire form, I carried him to my mothers car and started it up. She always liked to leave keys where someone could get them if they needed to........

I drove as fast as I could to the hospital, where just the night before I was working, my life seemingly as normal as it could be as a creature of the undead. I wont let you die David.... I thought on the brink of tears as I glanced at his unconsious form.
What kind of doctor would I be if I couldnt even save the one I love.....
~~~~~~~~~~~~~~~~
WEEE! Gotta love long bloody posts lol ^v^ Shes heading towards the hospital now, so anyone in that area will have something to do!

[Ultimate Charizard]

Keruga'Vyorn
-----------------

I walked into the reception at A&E later than i had planned. I shrugged off the questions of the Staff saying that i was down for some overtime.
I was hoping to get up to the research floor again but had decided on hanging around downstairs for the first few hours of my shift and see if my target decided to sneak in this way.

A few hours passed and i was beginning to get impatient. It had been unlikely that a vampire would try to simply walk in the front door but i had read a line in a book once, about some human detective that states 'any chance is a lead worth following'....something along those lines anyway.
I made a move towards the elevators when one of the receptionists came running down the hall looking for a doctor. As she passed she called at me to grab a Guerney and head to reception. I looked at the elevators, open as if waiting for me but decided my job took precedence. An injured human was more important than chasing down an unlikeley chance.
Rounding the corner into reception there was a young woman stood with tears in her eyes watching a group of Paramedics attending to a young man who seemed pretty badly beaten. This came into perspective as i noticed the girl too was pretty beat up but he was near death.

With the help of the Paramedics that had helped bring him in from outside we placed him on the Guerney. A faint scent caught my nostrils and i checked the Paramedics report. Broken bones, massive Bruising and lacerations all over his body were the obvious signs. He was also suffering from massive blood loss and had an extremely weak pulse. It could have been a sign of internal bleeding but i had recognised that scent. This man had been attacked by a vampire and the Girl with him Reeked of the same scent, the same scent i had picked up in the research lab. This woman had been my target all along.
I had never before encountered a vampire that had gone with its victim to the hospital but on further inspection i noticed the matching wedding bands on their fingers. This human had actually married a Vampire bride, that is why she now looked so concerned even though she had been the one to drain him.
I also smelled something else on them as i wheeled away the Guerney. A dark presence. Something much more than simple vampires this was as close as you could get to the Scent of Evil and i knew i recognised it, just not from where.

Moving into the Resus room i stopped the Guerney and backed off to let the real doctors do their work even though i knew there was no saving him. I took the girl out of the room and into a waiting room. It was standard procedure while the doctors did their best but it also gave me a chance to find out what i needed to know. She tried to resist, saying that she was a doctor and indeed one of the attending physicians recognised her, telling her she wasnt in a fit state to help.
"Hes gonna be ok" i said with false hope. She looked at me and nodded almost as falsely. Trying to convince me of her own hope. "You said you were a doctor?" i asked, trying to get answers without being cold.
She nodded "I.....I work upstairs. Haematology...." she replied between her sobs. "Then you know they are doing everything possible to save him". So she worked up in the blood bank. That explains the scent, an inteligent move for a vampire...at least for a reluctant as i now came to think she was.

A further 15 minutes passed before one of the doctors came in. It was bad news. The man had passed awaw a few minutes ago. Heart failure due to blood loss. A transfusion had proven inneffective.
She ran out of the room, back towards resus. I followed her, it wasnt usually my job to do the whole berevement councellor thing but with 2 vampires in the hospital i figured i could branch out my career.
I reached Resus and asked the couple of doctors by the door to give her some time alone, telling them i was some kind of family friend to explain my own presence. They left and i closed the doors behind them. At this moment i was glad that Feran demons smelled exactly like humans in their human form or i wouldnt have been able to stay this close for so long but i knew my time to make a move was soon.
I prepared to change and get some real answers when the evil scent reappeared. This time much stronger. I looked around trying to hide any alarm and then saw him.
The pale face and evil grin of the Master Vampire looking in through the window, gazing on his two 'children'. I growled under my breath, low enough that even vampires could not hear it.
"Ashram"

[Kuro Espeon]

WOW! That's a long post, Asi-chan. ( "That's a big post...") In fact, now I'm inspired! *rubs hands together* and the fact taht both of our characters are currently heading toward the hospital should make this alot easier.

Let's get this RPG back on track!

Roku Veradim:
~~~~~~~~~
I made it back to the hospital in very good time. it was now just turning 7:15 and the sun had completely set (it was getting later in the year so the sun went down earlier...) As soon as I set foot on the the grounds I could instantly sense a strong evil presence. I could also smell it in the air...the scent of a vampire...the same one from before. I could also smell the traces of Feran blood that no doubt belonged to Keruga'Vyorn. He was already here. And so was our opponent.
I proceeded stealthly and quietly, walking very lighting on my feet using techniques that were passed down through all generations of Dragon demons. Even though Keruga and this mysterious vampire had most likely already picked up my scent and knew I was here, it would still be best for me to keep a low profile. I reached the door of the hospital and reached for the handle...
But suddenly, something made me stop in mid reach. A new scent had entered the area. A strangely familiar scent at that...One I had smelled before.
I retracted my hand and turned around, watching the road. Less than a minute later I saw the long, bright beams of car headlights appear on the road, accompanied by the sound of a revved up engine growing steadily louder as it drew closer. The scent became more distinct and sharp. I narrowed my eyes...
Brandy Summers...
So...she was headed this way. And apparently her husband was with her, for I could also smell David Summers. But there was something about his scent that unnerved me. It was...different somehow....it smelled almost like....
"No!" I thought, my eyes going wide, "He smells like a vampire! That must mean...". My eyes narrowed again as I watched the car turn sharply into the hospital parking lot at full speed. I backed up into the shadows and kept a close eye on it to she were she was going. Instead of parking, the car took another turn and headed back behind the building, most likely to the rear entrance. "Now what is she up to now?" I wondered, watching the tail lights disappearing behind the corner.
I stared after it for a brief moment, then i looked back at the front door, behind which I knew Keruga and the vampire were waiting.
"Well, Keruga'Vyorn, it seems you'll be getting your wish," I said to no one in particular, "You're on your own for now."
I leapt off the front steps and made my way towards the back of the building where the car containing Brandy and David Summers had gone. While I was eager to seek out that strange vampire in the hospital, I was intrigued to find out what was going on with the Summers' and that curiousity was what drove me.
Brandy Summers....that vampire with a human heart...an immortal with a mortal's passion....I had to know the truth about her once and for all.

There! I finally got a chance to post again! yay!
Just so you know, Roku isn't necesarily there to start a fight. She's just investigating. If you want Asi, you can try to get Roku on your side by telling her about Ashram...*wink wink* *nudge nudge*

[Bulbasaur4]

Martye Coia tel'tehtar a.k.a Tella Me'arauko (F - Light Demon, currently in albino cat form)

*

So much had happened… it always had amazed me, even in the ancient times of how fast things seemed to move when things had gotten urgent.
I had followed Brandy all along, when she went to her mother’s house, up until David and Ashram came through. I felt compelled to help them… but I knew that if I exposed myself, I would be showing them something that was never supposed to still be alive. If I exposed myself… who knows what creatures would be awoken to extinguish myself.
For this time… I had kept my signature, my ‘call’ which reeked of ‘Light demon!’ under control. If I undid my cloak… it would be like creating an explosion in the balance of auras.
That’s a reason we lost the war… many of us didn’t know how to hide our auras. We were helpless… we had a beacon inside of us for anyone to sense us from the get-go.
I sighed, as I watched helplessly as finally Brandy some how managed to bring David to a car, and then quickly persued to go to the hospital. I quickly blinked and ran off to them… but the car sped away, and there was no use. She was hell bent on getting him there..
Such love… if only..
David, although going to be turned into a vampire, could die. I couldn’t let them suffer…
With that I closed my eyes, and instantly my form began to shift from a beautiful, sleek white cat to that of a large, hawk-like bird, purely albino. I felt my claws dig into the stone-like ground, as I blinked and the night-vision I had with in me came into view. I then opened my wings and quickly fluttered them with a large heave, and then thrusted myself into the air. I flew into the darkness, knowing fully well that the hospital was where they were going to go… and living in the city for more lives than even a vampire could imagine, I knew where pretty much everything was. It took little time before I navigated myself to the building where humans often healed themselves.

I flew… consentrating upon the building as I sensed them walking through the building, but I sensed another presense. Three. Three very powerful and definate signatures… a vampire… and two demons. Dark demons.
A shudder ran through my blood… Dark demons, though they were good intented in the beginning of the creation, they were tainted by vampires so long ago. Tainted… but then they seemed to distance themselves from the vampire race, but by then it was too late. The light demons, the race, was destroyed.
If only… if only..
But there was no use to wallow over the problems now. I sensed their movements had stopped, and fluttering to the window I felt them nearest, I saw Brandy, David, and the demon. I believed I sensed him many a night before… but I was not familiar with the names of the newer generations of dark demons. He was a Feran demon, that I could sense… the aura about him flickered much like that of a cat, and it hit me. The window was slightly open, and there was an outside panel for them not to see. Quickly I remained hidden from their view, as I heard Brandy crying slightly.
I shifted back into my albino cat form… and then as soon as it was complete, I leapt through the window into the room. I padded under the bed, as I gazed with my icy blue eyes up at Brandy and then at the demon… if he was a feran demon, and a demon alone, it would be hard to illude myself from him for long. Demons, dark even, had the ability to ‘sense’ better than Vampires as well… and if he was a feran, then he would be able to tell my cat form wasn’t a normal cat. But he was younger than I, much younger, so his memory would be not familiar with light demons. Of course, he would still be suspicious… and there was a sliver of demon inside of me which was relative to dark demons.
There wasn’t much time…
But then a new distracton came to be- Ashram.
His eyes went through the window, and I quickly ducked my head under the hospital bed.
I couldn’t help Brandy and David now…
Do I want to risk my life for the sake of two vampires? Do I want to risk ending it all now?
But the answer rang clear to me. So clear… that I even surprised myself.
yes.

These vampires had compassion… they loved each other. Was I to remain hidden forever, to simply watch the time fly by… and to watch things die, be reborn, and to watch this continously… lonely, forever?
I have always been so lonely..
Did I want to live that way… forever?
No.
Then, with the time I had, with the wisdom and powers that I held inside of me… why not use them for good, to aid against those who had killed my race. Why not help those against the elden ways of Vampires and the blood-consumed dark demons?
These two vampires was a start, and I for one, would aid that start.

But with Ashram here, trying to do my powers to David and Brandy would simply get them and myself killed in the process… all I had to do now, was wait to see if perhaps this Feran demon and perhaps the other demon I sensed, to rid Ashram. Then… then after I sensed I could trust the demons and reveal myself, I would do the unthinkable.
I would reveal myself, and light the beacon to all those who could sense a little of anything…
And I would aid them. I would heal and help repel their blood thirst…

I would do, what I finally realized, I was born to do.
For I was Martye Coia tel'tehtar, Destined Life of the Signs. I was Tella Me'arauko, The last of the light… it was destiny.
And I would use my destiny, to wield the powers given to me by life and fate, to strike back.



(Once you guys are done with Ashram, little white kitty will come out. But leave the part where she transforms to me. ^^ If Rudy and Asi, or atleast Asi remember the plan I had with her and those two.. ^^ )

[Bulbasaur4]

^^ Gav asked me to play Sakea, so here is a post for her!
Sakea'Sagran


Feran Demon(f)
*


The night was getting long, and the air was getting swiftly cool as I trailed this strange demon-auraed, stuck-up girl. Some thing about her was odd, and the words she had spoken much earlier still rung through my head. Even though they confused me slightly, I wasn't going to lie.
Following her was d*mn boring.
Through out the whole night, she had rummaged through several garbage containers... sifting through it as if trying to find some thing. Unable to find what she was after, she would lightly fall back into the thicker shadows to continue to walk. Why she kept walking... with no apparanent destination, was beyond me. One vampire had attacked her during my patrol- leaping upon the rooftops, eyeing her with my glimmering, hazel-green eyes. She had handled the vampire easily however... I had to admit, her skills were ruthless but yet efficient. Not that she'd be able to take me in a fight... but she wasn't half bad.

Still, it was boring. And being bored wasn't some thing I liked.

"She's fine... she's laying low, disposing of one-vampires... she'd be able to take two."
I shrugged, as I left my post and quickly darted back into the shadows of the night.


I lept through the night, stalking... and gazing to perhaps find a lone vampire or two, but for some reason it was actually hard to find one. Boredom was starting to become a severe headache...
"Hmm... nothing seems to be interesting tonight so far. Maybe if Keruga isn't pulling a late-nighter at teh hospital... he'll be at his little lair." I thought, smirking.
Sounds like fun to me.
Breaking my stride, I turned around, remaining in Feran form of course, and began to swiftfully head towards his little 'apartment'. After only a few, short dodgey minutes I found myself by the window of his apartment, and his window was easily jolted open. Sliding in, I shut the window and stretched on instinct- always had to stretch when inside a human-enhanced room. Sniffing the air and twitching my ears, it was obvious that Keruga was not home. Frowning slightly, my ears flattening against my head... I sighed.
" There goes my fun..."

I shrugged, deciding that if he wasn't home... I'd wait for him. No use wasting my time trying to find him when he can simply come and find me. Besides, I was hungry..
Going into the 'kitchen' area, I looked at the device which was called a fridge. It was still strange to see and try so many human devices... and refridgerators were one of the 'new' things for me, which I learned. Opening the door, I fished through it until I found some left over meat... seemed to be like chicken.
Chicken? Keruga, of all the meat... you keep chicken in your home?
I snickered slightly, figuring perhaps he wasn't able to pay for some of the other meats humans kept... or kill his own for that matter. Still, it would do. I reached in and helped myself to a rather large piece. Taking it with me, (leaving the door open), I headed towards where the nice, rather comfortable furniture was in his house. Sitting down, I easily disposed of the food and ate it quickly, feeling hunger had a grip on me the whole night with out me realizing it. After finishing off the last morsel, I threw the remains on the floor and gazed around the room. Keruga's living space was rather interesting... a few things here and there, a little empty to some human rooms, but it was enough to satasfy me.
The weirdest thing about the whole room though, was that black box. I've seen it turned on before, by a human when I was stalking a bar for vampires... but I didn't understand what it really was for.
How to turn it on?
Slowly I crawled over to the box, feeling particulary lazy, and I took my fist and pounded on it. It was almost as hard as a rock, and the thing didn't glow. No pictures. Nothing.
"Damnit! How does it turn on?"
I swore outloud, as I poked the box... and then in frustration I hit it again. THis time however, the tv suddenly let out a high frequency and turned on... and I scooted back, and saw the tv had a picture of several human girls.
Blinking... I contently sauntered back to the soft furniture, and curled up. Gazing at the tv, my eyes widened to find that these human girls were... were taking off their clothing!
"WHAT?!" I yelped... seeing naked, no-furred bodies was digusting enough with clothing and becoming one, but seeing foreign bodies of humans ...
"Disgusting matieral! Why would Keruga want one of these horrible, disgusting black boxes!" I exclaimed, turning my back to the box and closing my eyes slightly... resting and not looking at the box for now, until Keruga would come.

Hopefully he won't be a lolly-gager... he can shut off that horrible damned box..

[Asilynne]

Come on, I didnt make that big f-in post for nothing! Im giving this RPG one day to let someone post in it and then Im posting again!!! *cracks knuckles*
So, can someone please post in this in the meantime, or do I have to play Doc again ^,-,^

[Master Rudy]

David Summers
------
As I started to wake up there was just one thing on my mind and that was how weak I felt. Of course one thing was a bit surprising. For a guy that had just been tossed around like a rag doll there was no pain. However once I figured out where I was that was easily explained. Seems like I'm in the hospital. Well whatever they've got me on it must be some really good s***. I couldn't think of any painkillers strong enough for what had happened to me but I wasn't too worried. The important thing was that I was still alive even if it would only be a short time.

However I was soon about to learn that things weren't right.

Opening my eyes provided me with my first problem. Everything around me was just so blurry. Once I took off my glasses I saw exactly what the problem was. They're cracked. It must have happened when I was getting thrown around. Even so something was a bit confusing. I couldn't remember the last time my eyesight was this good without my glasses. It even seemed better than when I wore them. As I became more alert I thought I heard something on the other side of the room. Is that Brandy.....crying? Sitting up the first thing I said was "What's wrong Brandy? Everything's going to be fine now." At first she had her back to me but as she turned around she just ran over to me and hugged me. "I'm so sorry this had to happen to you David" she said as she hugged me. Before I could say anything she went ahead and kissed me. Normally I wouldn't have minded so much but Brandy's fangs had cut into my lip. However as I pulled away something quickly caught my attention.

They weren't Brandy's fangs.

Since Brandy was currently in her human form that could only mean one thing. She's not the one with the fangs. This time it's me. As I looked to my left I saw the heart monitor that I was still hooked up to was flatlining. Finally my skin was pale. Those were three signs that screamed that I was no longer a human. To be honest I wasn't exactly sad or upset. I knew it was coming. While it wouldn't make it easy to deal with at least I wouldn't have to find out the way Brandy did. My concern was the fact that I was in a hospital that had more than likely declared me leagally dead. If anyone saw me walking around the way I looked. it would raise too many questions. Looking at Brandy I said "We don't have much time Brandy. As much as I'd like to talk about everything that's happened we really should be getting out of here. How do I get back into my human form? It's already going to look bad if I'm walking around. However if I look like a vampire then we could forget about getting out." Brandy seemed surprised over the sudden seriousness but I could see she understood. "Well it's really not that hard. This is going to sound a bit strange but I really don't know how to describe it. Try to picture yourself as a human and remember what it's like along with an important memory. It's actually very easy." She wasn't kidding when she said it sounded strange but that's exactly what I did. I thought of the most important day of my human life.

The day that I married Brandy.

Sure enough before I knew it I was once again able to pass as a human. Brandy wasn't kidding when she said it was easy. After I had turned back she told me "Try to be careful about getting angry. That makes it harder to hold that transformation. Also not feeding will make it harder to pass as a human. I may have looked human when you came home tonight but I'm sure you remember seeing my fangs." Nodding I said to Brandy "Well right now the main problem is trying to get out of here. Do you have any suggestions?" Suddenly a voice on the other side of the room said "Well if you two are done with your little life after death reunion then perhaps it's time to let you know that getting out of here may be the least of your troubles." Hearing that voice made me jump and panic a little bit. Not only were we not alone but the person in the room also knew what we were. This doesn't look good I thought to myself......
------
Good to see this RPG has made yet another return. BTW that's Gav in that post making the comment at the end. I figured David would kinda be recovering from being dead for a bit and would be slightly unaware of everything and everyone around him

[Ultimate Charizard]

hope u dont mind i alter your plan a little Rudy but im gonna make the person making that comment Ashram...ill work it in ok but up till now i wanted Keruga hidden.

Keruga'Vyorn
-----------------

"Well if you two are done with your little life after death reunion then perhaps it's time to let you know that getting out of here may be the least of your troubles."
I had kept my eye on Ashram since i had been made aware of his presence. Still in my human form i had backed away, into the corner of the room where my uniform helped me blend in with the sterilised surroundings. The newly reborn vampire had not seemed to be aware of me and Ashram chose to ignore me, obviously uninterested in a meaningless human.
His words had come through the open window but he made his presence felt when he broke through the glass and settled onto the floor between myself and the two vampires.
"So, its complete, Rudy has joined our little 'family" He grinned what could only be described as a Sadistic smile. "Of course i still need to confirm his feelings or he wont be vampire for long, or anything for that matter, except dead"

The female, 'Brandy' i think i had heard her name was. I had also heard someone call her Dr Summers, she was the one i had been tracking. That scent was definitely hers. She stood her ground, trying to stare down Ashram. "The answer is the same" she declared. He merely laughed "I said i needed his feelings, not yours" he chuckled as he brushed her aside with a quick backhand, sending her into a wall.
"Tick - Tock - Tick - Tock" he taunted waving his finger with each step he took towards the bed. "Times up, learn to feed from those silly little cattle out there, or die"
The vampire stared at him trying to look defiant. "Still not sure? how about a demonstration..?"
Just as i realised what he had meant he moved over towards me, quickly lashing out and clutching me by the throat, lifting me into the air and carrying me over to the bed.
Doing my best to mimic the panic and fear a human would be showing i lightly kicked him in the gut during my 'frantic thradhing'
"If you dont cut that out"....he said lowering my face to his..."Ill pull your leg off you annoying insect"
Realising this was my chance i took hold of his wrist and kicked again, this time much harder, using my full power as i let my transformation take hold. Ashram fell to his knee, winded from the gut shot as i squeezed around his wrist and twisted it away from my throat.
"Next time Ashram" i growled "Pick on someone your own size"
I released his wrist and swung a fierce kick at his head which connected and he found himself flung against the wall. Reaching into my pocket i grabbed my keys and threw them onto the bed.
"You two, leave Now!, the address is on the keyring, he wont follow you there. Ill have a little fun with him here while you get away"
Focusing back on Ashram he had Just returned to his feet. "Feran" He Spat. "I dont know why you Demon breeds insist on getting involved in MY Business, especially after the warning i gave your leaders"
"Sorry, im more of a freelance operator" i replied waiting for his attack...
He seemed to think for a minute...."That must mean your Keruga'Vyorn...oh they say your good....this should be fun!"

[Bulbasaur4]

TELLA
- Martye Coia tel'tehtar a.k.a Tella Me'arauko - Light Demonic - F (albino cat form)

*
So... the dark demon had some good in him? It shocked me severely- all the dark demons I had ever known or seen had no good intentions. But he called himself sort of an outcast... a freelancer... perhaps there were a few amongst the dark which were good. That provided to be interesting... perhaps if there had been more time, Tella would have asked him many questions.

But there was no time.

The two now both vampiric couples were shocked... but they took the keys and fled. I took after them, my white tail wavering in the air and I stopped at the doorway to look back at the feran demon who was taking on Ashram. My gaze met Feran, his name now I knew to be Keruga'Vyorn. He looked at me... and I suddenly felt a shiver as I felt him see me as an oddity. But he quickly turned his gaze- seemingly unwillingly- back to Ashram who was ready to attack. I sighed and quickly scampered off after the vamp couple.

It did not take long to follow them, their aura and scent was upon everything they walked upon. I followed them quickly. I HAD to help to the two before some one else might try to intervene. Before Ashram ever found us again... They were heading towards the feran's home, and I knew that it would be best to do this before than. With the one named David weak from becoming one of the undead, it was only a matter of time before he'd need more blood.
Not if I had anything to say about it.
Summers. Stop young ones.
I was taking a huge risk... but I knew it was nessicary. Either I fight now, or never fight. I was not going to make the same mistake I had made many thousands of years ago... The two vampires stopped slightly, the female looking quite untrusting and both looked extremely nervous. I meowed, quickly coming to them and Brandy's eyes looked extremely shocked.
"Snow..ball?" I heard her tiny voice, well- tiny because of shock that her cat which was supposed to be in an apartment high in the city was suddenly on the ground and following them.
"Snow-what?" David asked, and Brandy looked at him. "She is a cat i found tonight... I named her Snowball- I thought she was in the apartment..."
Yes. I followed you and I k now your dilemma. David is now a vampire, and Ashram has some sick twisted game of making the both of you drink human blood. Now you are headed to the feran demon's home in pure trust.
THe two of them dropped their gaze back to me, and I meowed again and sat.
You call me snowball. I am not anything you young ones have ever heard of... in fact, there is no other like me in this world except for memories. I have followed you because you two have intrigued me... you are vampire and he was a human, and you both sacrificed each other for love. I thought all vampires were evil, and that most human stupid and careless. But I see now... that there may be an exception. That is why I wish to help.
"Are you a cat?" David asked, and I laughed...
Truely? No. My true form is hard to explain.. I can shapeshift into many things. But my true form isn't far from yours... it is humanoid. Very much alike. But we haven't time... when we get to the Feran's home, I will explain more. What I offer you now must be done quickly. I want to help you. Before It ell you how... do you trust me? Because I must trust you.
The both of them turned to eachother, and they conversed... but finally David looked to me.
"We've met many others trying to kill us... and I figure if you wanted to kill us, you probably would have done it now... so... we'll trust you. But why must you trust us? Surely you know we wouldn't hurt you... if you've watched us for as long as you say you have."
I can only help you by coming to my true form. (http://www.pokemasters.net/forums/attachment.php?s=&postid=218629)But by doing that... my aura, or signature- much like how you can sense a vampire from a human, will be revealed. Unlike dark demons, I am a Light Demon. Our signature is rare and few vampires or dark demons remember or know of Light demons anymore. But the signature is so vibrant, so intense- that any of the dark demons or vampires will be able to find me easily like a glowing light in darkness. I cannot hide if I help you... but that is a risk I am willing to take.
"How?" Brandy asked.. their interest sparked.
You will not need to drink blood ever again, nor will you thirst it.
The two of them looked stunned... but Brandy mostly. I couldn't wait for their answer tho, and even if they said anything I would not hear it. I was transforming...

My cat body suddenly glowed into a blinding light, and rays of light penatrated the darkness- temporarily able to blind any human and hurt a vampire's eyes only slightly. My form suddenly grew- looking only like an outline of light, as my cat body grew and the fur started to vanish. My short muzzle grew into my head, and soon my ears shrunk to that of a human but pointed only slightly. My head grew long, viberant and very beautiful adn stunning ribbon-like blonde hair, as my arms grew and fingers split. My legs grew as well, and soon ribbons of not simple light, but blue-green light wrapped around my body. Soon they formed into clothing around my naked body, forming like that of armour. Soon my body was fully complete, but markings upon my face formed and I looked to them feeling complete. Their eyes were wide open... and I knew why.
They literally could 'feel' my presense unlike any other... it was like putting a person in a boiler room- you could feel the heat immensly. But I knew it wasn't a bothersome feeling... the aura of a light demon was pleasant and calming to those of good nature. It was welcoming and friendly... full of optimism an dhope. Some thing these two needed.
"There is no time. Come closer." I spoke, my voice light and airy... slightly angellic if I may say so myself. The two didn't move instantly... but slowly they did. I quickly placed my hands upon their heads, and it was as if David was to speak but I already began to speak instead.
"Drawlievia ishmal terickla! Tel'mainia celtica murishmay!" My hands instantly erupted into a fire- but only thsi fire did not burn and it was a blue in color- but it wasn't a solid blue. It was water like... looking like water, except hungery like flames of the fire.
"...moria drankui serenia Brandy cyi David Summers isla vampiricea morea no balasaic.."
As I chanted, the two of them gasped slightly in their own way- for the feeling of my light aura insatntly sank into their bodies and the experience was some what relative to the feeling of pleasure and sickness all at the same time. The feeling collapsed around their bodies and swirled inside t heir souls... and both of their eyes glowed slightly golden.
"... duria monage la faerai mellonka trai!"
With the last word, my hand's fire like aura vanished, and soon Brandy and David returned to their normal state. They both looked up at me, their skin pale but almost a little fuller now... and I smiled as blood dripped only slightly to the ground from my face. A clean cut formed upon my cheek, and it dripped only a few drops to my chin and then upon the ground. My arms which had brown cloth around them, were ripped- both the cloth and my arms. Although there were many slashed upon both of my arms and around my collar bone line, only half of them bled. Still, it was quite enough of blood- and my blood was exactly all red... actually my blood was a deep blue intermixed with only a few dots of purple and red.
"What happened?!" Exclaimed Brandy, as they both found much strength to go to me as I smiled weakly, tasting my own sweet blood upon my lips. Not that I liked blood... but my blood was sweet by nature. Perfect for vampires. Brandy and DAvid however could smell the sweetness... but they did not hunger it. My work had been successful.
"It... it is nothing. A price I pay for healing. For every soul I help, depending upon how strong or severe their wounds are... I must be injured. However you two were not injured, but I made you not thirst for blood anymore. THat is equal to a wound about the size of two broken legs. I will bleed... I will be weak for a little while, but I will manage if only you will help me walk but just a little to the feran's home. I trust he is true to his word and good in deed."
With that, I smiled yet again... a painful but true smile.
[/color]

[Asilynne]

~~Brandy Summers~~
Better to have loved and lost, but best to have lost and found.
:::7:37PM:::

David.....who was dead but alive...

Asram....who was busy but not for long...

Snowball....who was my friend but not really a cat...

So much had gone on in this night, this night that was just beginning. So many things happened so fast...the night before seemed normal like the calm before a storm...but tonight everything had changed in the blink of an eye.
And now, that my cat had turned human and placed her hands upon the heads of David and myself, I felt a tingling warmth spread throughout me, and when it was over I felt distinctively different. Blood was dripping off her newly human arms, blood flowed from a cut on her face, sweet blood, I could smell it....but I wasnt hungry for it, like before I wouldve been. Looking over at David, I could tell he was feeling the same way. I smiled slightly, tears beginning to form in my eyes. David. I had thought Id lost him, I had thought he was doomed to the horrible feelings I had had to deal with for so many years, but now he need not ever know the hunger for blood, he wont ever have to drink cold blood or desire it from the living. It wouldve killed gentle David to do that.
Like helping me had killed my mother... I bit my lip as I remembered what else had happened tonight. So many people have been hurt because of me...my mother was killed because Ashram followed me to her house....and David.... No. Now was not the time for self pity. Ashram was still in the building, but if what Snowball said was true, it wouldnt be for long. I could sense her aura, like a beacon announcing her prescence, and as long as we were close to Ashram and near her, Ashram would sense it, and come looking.
He would find us......
“Thank you.” I said quietly to my former cat. “Is there a way for you to become a cat again? We need to get out of here quick, and Ashram is sure to feel your aura if you stay like that.” She looked pensive a moment, then nodded. “ I can.”
With notably more difficulty than before, she sank back down into the furry albino cat I knew. Scooping her up with one swift motion I looked to David. Taking his hand gently in mine and cradling Snowball with the other arm, I said, “Lets get out of here.”
As we ran down the halls and finally out the door to the outside David read the address on the keyring the ‘creature’ had tossed to us. “This place is only a few blocks down.” He said as we stopped running for a moment to get our bearings. “We can make it in about 5 minutes if we run.” He stopped studying it for a moment and placed his hands on my shoulders, looking into my eyes with a concerned, questioning look. “Youve taken quite a few hits, are you ok enough to make it there?” I nodded, and smiled. “Ill be ok, Im not the one who died today.” I laughed slightly, trying to make light of the dark situation we were in. He chuckled. “Ok, but if you start to feel like you cant make it tell me.” I nodded but before we started running again I came forward and with my free arm, drew David into an embrace. “Ever since this night started things have tried to tear us apart.” I said, my voice choking up slightly. Holding me tightly against him he shook his head. “Nothings going to.” He looked into my eyes and put a hand on my cheek. “I wont let anything happen to either of us. I promise.” Overwhelmed with the reassurance and hope Davids words had given me, and happy over the fact that he was alive, my eyes began to tear up and I was unable to speak.
But right then I didnt need words.
David and I kissed, saying how much we loved each other and conveying the hope we would make it out of this together without even saying a word. It was the first good moment we’d had all night, a perfect moment...but an anxious ‘mmrrrrraaaoow!’ brought our attention to between us.

Such love......and Im sorry to interrupt, but its a bit of a tight squeeze where Im at.

Laughing slightly we drew away from each other. For the moment we had forgotten everything but each other, but now we had to concentrate on the matters at hand. As we sprinted down the streets towards the Demons home, I wondered what kind of a safe place it was that could hold out Ashram. I had seen his power, I hadnt been enough to fight him off. It seemed hopeless...but I knew there was still hope.
As long as David and I were alive and together, there was always hope.
~~~~~~~~~~~~~~~~~~~

EDIT: I noticed a line was missing so I fixed it, the new board thought it was html because it had carrots around it :P

[Bulbasaur4]

SAKEA

Feran Demon - In Keruga's apartment - F

*


The damned noises kept playing...
... and playing..
... and coming from that DAMNED black box! horrible noises that female women made for some horrific activity. I had peeked once, hoping it had gone away only to have seen some thing myself in my right mind would never want to see. After that, I turned once again to close my eyes again but the box kept talking... and moaning..



However, in the midst of that I suddenly heard footsteps. Instantly my ears pricked forward... and my eyes opened, as my ears twitched as the sounds of footsteps from the long hallway which was another enterance into Keruga's 'lair'.
Some one is coming...
I was unsure of it first, but then it hit me. Two Vampires.
Feeling the hair rise upon my back, my whole body began to tense- especially in my legs as I remained laying down. The end of the couch I was in hid me from view if the door was to be opened.

And it was.

Two vampires... obviously not aware nor trying to look at me yet- they were to busy looking towards the kitchen area and talking softly. One female, One Male. The female took a stepforward into Keruga's lair...
Vampires should not intrude here!!
My mind screamed, and instantly with one swift and fluid motion I leapt high into the air and landed in front of them.
"Damned you creatures! Having the nerve to step into a demon's home? Well you shall travel no furtherrr..." with teh end of my words, I slurred it into a growl and panic and fear instantly flared into t heir eyes. They were both weak... and if I attacked they would not last long... and they seemed to know it.
"Wait-" The male began, but suddenly a little voice in the back of my mind- or a sense rather, alarmed. Some thing deep inside of me stirred... as if telling me some thing 'not right' was here- other than those two vampires. It was strange... if some thing that wasn't supposed to be here, was here... why didn't I sense it clearly?
Suddenly an albino cat jumped out of the woman's sleeve...
The sudden jump made me take a step back, but at the sight of a cat I instantly smiled. I feared no cats and they did not fear m-
Then the alarm hit me like a wave.
Some thing was not right about that cat... it was not a cat. I was part Feran... I KNEW what a cat's aura was like. Although there was a sliver of cat inside of the... feline's body, it wasn't one... it was so hard to describe. In fact... I sensed almost a demon part of it... but it was twisted- it wasn't a demon either..
"DAMN!" It frustrated me and I instantly came to the conclusion that these two vampires must know what was wrong with it.

Before the two of them could react, I charged the female vampire and immeidatly had my hand around her throat, my claw right by her juglar vein.
The male was about to intervene... but he hesitated, seeing the position his friend was in and because I had not harmed her- only pinned her again the wall but her feet were still upon the ground.
"Tell me now- what the hell is that... that thing!" I declared, and the female's eyes were confused but yet they hid some thing.
"What t-thing?" she said, her voice strong but obviously shaken up by how fast my movements were.
"That... 'cat' -if you can even call it that! It's not a cat! What IS it? Some sort of new vampire's twisted GAME?"
The women vampire did not know how to respond... but after 5 seconds of silence, suddenly the male spoke.
" You're right! It's...it's our pet. A vampire-mutated cat. 'Us' vampires invented it... or mutated it rather, so it was a cat but it's blood is not the kind we like to drink, and we enhanced it with other properties."
I instantly glared at him.. "I did not ask for you to speak!"
But I let the female vampire go, taking a few swift steps backwards as the albino 'cat' stared at me not too far away. I knew they weren't telling me everything... but the cat's aura wasn't threatening.
" Alright then... I'll give you a chance to get the hell out of here."
"B-but the demon said-"
"Keruga!" I hissed.... my eerie green eye sflashing. "Did you kill him?! How! Such weak-"
"No no! He saved us back at teh hospital... he gave us his keys and told us to stay here until he returned... I believe." The female responded.

I took a few efforts to ponder... Keruga, sparing the lives of two vampires? Why?
"Why would he do that?"
The male now spoke... his voice more grave, almost a whisper.
"He was helping us escape Ashram... we're not like him or other vampires. We don't drink blood."
With this I was clearly shocked... obviously I'd needed Keruga to tell me the other side of the story.
"Alright... alright... I'm not completely irrational here. As far fetched as your story now seems to me... and I am being polite to say just 'far'... but I'll allow you to stay here until Keruga gets here. Then he can confirm your story if it is true or not."

Despite everything that told me to kill these two now, part of me wanted to believe them... I mean, two vampires not drinking blood and rebeling against Ashram? It was a dream.
"But, I'm staying here too because... ....well, that's none of your business." If I could have blushed, I would have- if I was not in my feran-humanoid form.
" Anyway, I'll keep an eye around you an-"
But before I finished, the two vampires heard a loud moan and looked to the disgusting, horrible black box.
"What the hell!" The male vampire said... and I looked to the black box and shivered.
"You're watching... watching... PORN?" The male vamp continued to say.
"Porn? What is... that?" I said, still alert but curious- obviously this vampire knew humanoid things.
"Porn... is what you were watching on that screen right there!" The female stated.
"WATCHING?" I suddenly hissed and growled, shaking my head furiously.
"I wanted to know how to turn on the black box... to see if it actually worked like I saw it before in a human environment. The thing started showing pictures of naked women- like it is now, doing extremely disturbing things! I don't know how to make the thing stop showing pictures!"
With that the two vampires laughed...

[Bulbasaur4]

Oh, and here is a picture of Sakea in Feran form!

[attachment deleted by admin]

[Asilynne]

To the cast of Sins of the Blood:
Im sorry but I will no longer be posting. This was one of my favoite RPGs here at TPM and Im sad that I wont see the end, but it has to be done. When I joined this, TPM was a fun place to be, and it was fun to write stories about mystery and intrigue, blood and feuds, love and honor. But far too much has been happening behind the scenes, and broken trust and betrayal, something you might see in an RPG, has manifested itself on how this place is run.
When the people in charge, who are supposed to help people and provide guidance, get so power-hungry and spiteful that theyd screw over a fellow person, a FRIEND, that is when it starts becoming less fun. The system is corrupt, and I want no part in something that allows betrayal of friendships to happen. I want no part in a place where people who act nice and innocent, and smile in your face and call you friend, stab you in the back when your not looking.
Its been fun, and if anyone wishes to continue to RP with me, feel free to give me an IM. But I wont stay in this corrupt place any longer.
Farewell,
Asilynne Outlaw

[Ultimate Charizard]

Right. This RPG has been 'inactive' for over 2 years but not deleted and we left it at a point where the climactic sequence of events was about to start. Problems between members making it difficult to continue.
With the agreement of the current cast (a couple of which are due to return to tpm) i would like to revive and finish this.
Its one of my top 3 RPGs to particpate in and it deserves an ending.

[Asilynne]

HELL YEAH GAV HELL YEAH!!!!! Ive been dying to finish this RPG! Its one of my favorite ones ^v^ DAYMN! Me and Rudy are definately in ^v~

Will JT return as Ashram though? Itll be no fun for you to 'fight yourself' in a way if you have to write the ending battle by yourself lol

[Bulbasaur4]

YAY! I love this RPG. Albino cats rule. Plus playing Sakea was fun! ANd my tortured demon girl! WOooo...

I also think it would be HIGHLY amusing to watch Gav fight himself... but I also think it would be nice if JT could join in the fun too. ^^;;

[Ultimate Charizard]

Right well if its ok We can wait for Asi and Rudys return although as it stands i beleive myself and JT have a fight to finish. If noone minds i wouldnt mind pushing that forward and getting things moving. Ball is in your court JT.

[Kuro Espeon]

Whoooooa....talk about a blast from the past! O_O Haven't seen this RPG in a while... I'd have to go back and review it when I have more time (at the moment I have two papers tat I'm working on that are both due this week, and then soon after that I have finals to study for...-_-). But once I get the chance I can try to catch myself up on this. Playing Roku again after two years would probably prove...er....interesting... XD

[Outlaw JT]

I am in the process of reviewing the RPG. As soon as I have had time to catch up on it I will post. Will be by Sunday at the latest. Sorry for the delay but I will get to it as soon as possible. I am about halfway through the RPG now.

[Drusilla]

Return of the Living Dead... RPG! Bwahahaha...


~*~Drusilla~*~

She looked at me from beneath that strangely purple hair of hers but didn’t say a word. For the first time ever, I simply allowed my prey to turn and walk away without any struggle. I shrugged; while I was charged with capturing this half-demon creature, I had seen her fight and I wasn’t feeling paid well enough to risk a confrontation at the moment. My price was going to rise; now it was time to find the boss and inform him of the influx.

For such a large city, he wasn’t really that hard to find. Sometimes he was… but when in the human realm above ground, he was easier to track. I traveled by rooftop, as usual, following the scent of power. I had a feeling…Yes, he had gone to the hospital, but… why?

I was answered indirectly when I sensed the presence of other vampires. They were heading away from the hospital, with a third… a third who had power of a kind I had never seen before. Ashram could wait; my curiosity was peaked.

They entered an apartment building. I didn’t follow them, but felt their power move through the halls until they came to a halt. I moved to that side of the building, climbing down the fire escape to hang upside down from the railing so I could look into the window.

A Feral was upset about something… the two vampires were Brandy and Rudy Summers. I grinned viciously. What could be more fun? I wouldn’t do anything, though, not yet; I would let them find me, if they happened to look. If not, then I could trail them. My concern with the half-demon was on hold until I either secured a higher payment or was dropped from employment. I was on my own for entertainment for awhile… I settled in and let the scene unfold before me.