Page 1 of 3 123 LastLast
Results 1 to 40 of 92

Thread: Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

Hybrid View

  1. #1

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Here we go, lets see if this can get off the ground.

    Name: Keruga'Vyorn of the Feran Clan (Gav for Short)
    Race: Feran Demon
    Age: 20
    Looks: Totally Human in appearance it is only obvious when he shifts into his demon form becoming feline in appearance. Elongated Fangs, catlike eyes and large black furred ears on top of his head. A long black tail accompanies the patches of black fur that appears but not toally covers his body. Wears a Black T-shirt, Blue jeans and Black Fingerless Gloves. His transformations dont bother the clothes too much, except for the tail. Sometimes wears a black long leather coat.
    Abilities: Heightnened Senses, Speed, agility, Balance and some strength, he is a virtually upgraded Vampire in most abilities but strength.
    Personailty: Likes a joke, is a young hunter and therefore can be a little cocky. Taking too much pride in his abilities. A fan of human movies he likes to quote films and attempt moves from martial arts films as if a fight is a game. Very loyal and protective to those he calls friend.
    History: Born and trained like every other young Feran in the martial arts of the Clan. As he entered his teens he became rebellious. One of the top of his class he ventured out alone. Still keeping ties with the clan but living as a human. Becoming accustomed to the Human culture and its customs. Eventually learning of the human martial arts he learned and mixed the Demon skills with the Human styles creating his own hybrid fighting style. Has become a skilled Hunter at night while living a relatively normal human life during the day.
    Allegiance: Demon Clans
    Other: Fights with a Katana sword and a handgun (similar to the on in blade). Works in the local hospital as a porter during the day. He sees it as a good way to get leads on 'suspicious injuries'

    It begins.

    Keruga'Vyorn (Gav)
    -----------------

    I sighed as I closed my locker. My shift had just ended and I headed to the shower throwing off the stained medical smock. Working with the general public was a fun enough job but Sundays were always the worst. Dealing with those that had gotten a little too enthusiastic with the alcohol and other substances. One young man had come in reeking of a fine mix of alcohol, urine and vomit. To my colleagues it was simply a bad smell. With my sense of smell I could pick out every detail, hell I could’ve probably tracked the scent and followed this young drunk's exact route from the night before. It was a horrendous stink and I almost wished I had the inferior senses of my human friends. As I had helped him from reception to one of the examination rooms he had found it a good time to once again empty his stomach and the resulting mess was only the beginning of my day. Now it was just after 3pm as I washed away the remaining traces of the odour.
    Drying off and returning to my locker I pulled out my clothes and got changed. I thought I heard a scratching sound but it was so faint I paid no attention to it. The soft giggling sound I heard did catch my attention however and I looked around. There was a scent in the air. Flowers....at least something close to it and the giggling got louder. Suddenly a noise above me and I looked up to see the ventilation shaft cover swinging and a soft feline face smiling down at me.
    "Sakea?" I asked puzzled. "What the hell are you doing here?” Sakea'Sagran, another member of my clan, and my best friend slid slowly from the vent and landed on her feet in front of me. "How ya doin" she asked giggling again. "You shouldn’t be here" I said, scolding her even though she was slightly older than me. "Oh sorry" she said as she looked around. She seemed to concentrate and her feline features regressed into a perfect human form.” I forgot, been a while since ive been in the city" She raised a hand to brush her long red hair from her eyes and smiled again. "I don’t mean that" I almost shouted. "Don’t you know this is the men’s room, no females allowed!"
    Her grin grew wider "I know, ive been waiting for you for a while but I didn’t know where to look. I figured you’d come in here sooner or later" She paused and seemed to look into the distance. "You know, human males are really funny to watch, I mean for one thing...." I cut in fast changing her line of thought. "Why are you here, it’s a pretty long trip from the clan". She pouted and looked hurt "What sort of greeting is that for your oldest friend?" she asked. I smiled as I started to calm down and I caught that scent again....it was coming from Sakea. "Perfume?" I asked and flashed my cheesiest grin as I pulled on my shirt and closed my locker. "Since when did you decide to join in with the human culture?” She punched my arm playfully. "I just thought id try a few things" she smiled as she sat on the bench beside me. "Taking after my inspiration" I looked at her slowly and pointed to myself? She nodded slowly "A number of the younger Feran have been talking about you lately, 'The wanderer' living amongst the humans. Being your best friend has given me a great reputation. Besides I missed you" I tried to tie my laces as she hugged me around the neck. I smiled and grabbed my bag. "You eaten yet?" I asked her. She shook her head "I haven’t had chance to hunt yet" I laughed; I had almost forgotten the old ways. "Don’t worry the advantage of having a job is you don’t need to hunt. You’ll have to head out the way you came, wont look too good a good looking girl like yourself coming out of here with me. Meet me outside the main entrance in about five minutes ok" She blushed at the complement but it faded as her features grew feline again. She span and leapt nimbly up into the Vent. "See you in five" she called back as she vanished into the dark vent. I jumped up and playfully batted the tip of her tail that hadn’t disappeared. Closing the vent behind her I gathered up my things and made my way to clock off before heading out.

    As I stepped out into the fresh air I saw Sakea leaning back against the wall. She had changed back to her human form once more. I noticed a couple of the junior med students watching us. 'Checking her out' I believe the expression went. A smug smile was on her face. She wasn’t looking but she knew she was getting attention. "Not half bad for humans" she teased, keeping her voice low so only I could hear. "But they’d probably scream and run if they knew what I really was" She laughed to herself and I looked over at the young men. "Actually knowing those guys that would only get them more interested" I added a small laugh of my own as she turned and began to walk towards the street. "Well it makes no difference, I don’t go for guys that aren’t even my species" She seemed to strut out onto the sidewalk, her stride full of confidence. We walked to a small restaurant. I knew the place well as it was one of my favourite places to dine. It was mainly a human diner but if you had 'membership' there was a reserved menu for the less common customer.
    We went through into the back room and noticed a number of other demon breeds. Of course anyone simply looking through the door into the back wouldn’t know any different but a nose knows. We sat and ordered. Occasionally I would try a human dish but usually it was the demon cuisine. You know the taste of home. They had a Rat Stew here just like mom used to make before id left for the City. Today I had decided on a human meal, couldn’t hurt to show off my adaptation to human food in front of my old friend. I ordered a gammon steak; fair enough it was a nice thick slab of meat but the accompanying vegetables, potatoes, egg and even pineapple rings that came with it wasn’t something id usually go for. Sakea had watched as they brought my order out. She took an inquisitive sniff and licked her lips at the steak but her nose wrinkled up towards the rest of the meal. She had opted for a more familiar Feran dish. It was basically a mix of all the best meats in a thick Gravy. This also hinted at how much training Sakea must do. She had always been a fan of the 'one Feran Feast' yet her body, even in human form was lean and muscular yet not too thin or too butch. A female hunter could use her looks to draw in any stupid vampires unfamiliar with her scent and Sakea was the sort of female you couldn’t resist even if you did know she would kill you. After the meal we headed back to my apartment. It was getting quite late in the day now and the sun would soon be setting. I had things to prepare. "I unlocked the door and Sakea stepped in. "Your going soft" she simply said.”Living in a luxury home, buying food rather than hunting it" She looked me square in the face, her eyes burning into me. I looked around. Luxury wouldn’t have been a word id use to describe this place but compared to the cave and forest background of the clan I guess it was pretty nice.” So you think ive lost my edge?" I said a small growl present in my voice. "I do" she said in reply "Living among humans has made you weak" she matched my growl with one of her own. I grinned to myself and looked at her. I had missed this. Sakea regularly used to challenge me, testing my abilities keeping me on my toes as we were growing up. I smiled brightly. "I really have missed you" I said, the growl completely gone from my voice. She raised one eyebrow and shifted her feet. At that moment my hand flashed out, grabbed her wrist and twisted. As I turned she was flipped over onto the couch. "Looks like im not the one who's gone soft" I said with a wink. She growled and threw a cushion at me.
    "How long you planning on staying?" I called as I headed to my bedroom to prepare my weapons. "Well that’s the thing" she began "Im thinking of setting up like you" her head peeked around at the doorway. She was back in her Demon form. She had always preferred to be herself than disguised. "If its ok id like to stay here while I can get a job and a home of my own"
    I held back a laugh. It was well known that Sakea had never been too bothered about the human life but it seemed something had changed. "So that explains the perfume" I laughed out loud, "sure you can stay here as long as you want, there’s another bedroom there behind you, its yours" She ran in and grabbed me in a hug. In our different forms her strength advantage was overwhelming and I found it hard to breath. She laughed and squeezed again just to add to the pressure then thankfully she loosened her grip. "I knew I could count on you" she beamed and seemed to bounce back out of the room.
    "Tell you what, since it seems were gonna be roomies you may as well help me out. It’s been along time since ive had company when out hunting and I could show you the city, learn your way around.....well start tonight"

    Afterworld ~ Chapter 2 | Blood Bowl ~ Chapter 3
    If nothing else works, a total pig-headed unwillingness to look facts in the face will see us through.

    ASB Record
    W-12 ~ D-2 ~ L-2

  2. #2

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Name: Ashram Marduk (he is called Hammurabi by the eldest vampires)
    Race: vampire
    Age: His true age is unknown but he is the only known ancient left among the vampires.
    Looks: 6'7", long jet black hair, short triangular goatee, very broad shoulders, wears a black hoodless cloak, black pants, white ruffle shirt under a tight red vest. His sword remains hidden under his cloak. It is made of an unknown black metal and has the image of a long forgotten god etched on its blade in silver
    Abilities: His strength and speed are unrivaled in the known demon world. His other senses and physical abilities are on par with the strongest of demons or vampires.
    Personailty: Calculating, aggressive, intelligent, confident, ruthless.
    History: His true origans are unknown but he can be linked back as far as the Babylonian empire. He came to Pernicious very shortly after it was first built. At first he was the lead general of the previous vampire ruler. Around 1860 though the previous ruler grew weak for unknown reasons. It was at that time that he became the ruler of the vampire nation. He took it upon himself to kill the former ruler to put him out of his misery. Since then he has slowly taken a more aggressive approach to his rule. He thoroughly believes vampires to be superior to all the other demon breeds and most especially to humans.
    Allegiance: He is the vampire ruler.
    Other: He is the oldest known vampire left but he assures others that he is certainly not the original.


    Ashram Marduk {Hammurabi to the eldest of vampires(eldest being older than 2000)}
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

    The last rays of sunlight crept slowly across the floor of his main chambers. Most vampires would be afraid to have the daylight reflected into their domain but not him. He embraced its presence. He counted the hours buy it.
    When Ashram took over the first thing he did was have a series of mirrors rigged all the way from the surface so that the suns rays would reach a singular strip of his main chambers. His reasoning was so he could measure the length of the day so he could better prepare for the following night. Really though, he was just fascinated by the sunlight and the fear it instilled in his brethren. The closer he was to fear, the easier it was to overcome. The presence of sunlight also served as a wonderful tool of intimidation when dealing with subordinates.
    Eventually he tired of his sungazing though, and he once again began reading the reports that had been brought before him earlier. Such mindless beuracratic nonsense but he could not foresake the day to day tolls of rulership.
    "Tels'Teth, I believe another meeting with the mayor and police chief are in order. They have started becoming a little too efficient in the red sectors of Pernicious. It does not serve anyone well for one of their uninitiated patrolmen to stumble on one of the feeding clubs. Also, the medical examiner out of Pernicious General Hospital has begun raising too many questions. See that he is eliminated quietly and replaced with a suitable doctor. One more easily controlled. On a side note, you need to preper a speech about feeding zones and prey types and caution. We can't just have every vampire leaving everyone and anyone they decide to snack on anywhere they please. Anyone with a higher social standing than homeless simply must be disposed of properly," Ashram said plainly. He had no enthusiasm left for boring matters of state. His interests lie elsewhere at the moment.
    "Will there be anything else Lord Marduk?" Tels'Teth replied tentatively.
    "One more thing, yes. Have my hunters found anything out yet about the........the special prey?" Ashram replied carefully.
    "No, sir. They are still searching for whatever it is you sent them after. As I understand it they are following some rumors among the lower demon communities but nothing major so far," Tels'Teth hesitantly answered back.
    "Very well then. Let the generals know that we will not hold assembly tonight. I have not roamed the streets of Pernicious for quite some time. I think I shall have a stroll this evening. Those demon hunters need to be reminded of the error of their ways!" Ashram said with cold precision.
    As Tels'Teth left Ashram got up from his seat of power and walked over to the last of the fading lights of day. He paused at the very edge, a mere inch from its dying warmth. He stretched his open palm out towards it but stopped a fraction short of its receding boundary.
    "Soon," he whispered to himself. "Very soon now."



    OOC: just so you know the medical examiner mentioned is the one that works in the same hospital as Asi and U_C's characters.

  3. #3
    Just Too White & Nerdy Advanced Trainer
    Advanced Trainer
    Kuro Espeon's Avatar
    Join Date
    Oct 2000
    Location
    Virginia
    Posts
    2,099

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)


    Name: Roku Veradim
    Race: Dragon demon
    Age: her actual age is around 1500 (her clan has incredible longevity...) but physically she looks to be in her early 20's.
    Looks: About 6'2 in height and very lean. Long jet-black hair with two strands of blood red in the front and mysterous red eyes that seem to glow. Her skin is slightly pale but still has a little bit of color. Has a set of sharp fangs and talons (or claws, whatever...) and long, pointed ears. She normally wears a black, baggy kimono top that is fringed with red and gold and knee-length oriental-style pants of matching color. On the back of her kimono top is the Japanese symbol for "Shadow Dragon." (Also has a dragon form...will explain this later) When she chooses she can bring out her large pair of red dragon wings.
    Abilities: Very agile and fast and has very keen senses, making it easy for her to track her enemies or know when someone is about to attack her. Has some slight psychic and telepathic abilities as well and can also transform into a large black, ruby-eyed dragon at will. (Doesn't do it TOO often cause it wastes her energy)
    Personailty: Very crafty and mysterious. Her sarcastic and cynical attitude tends to confuse some people as to how she really feels and where her true loyalties lie, but she is always true to her word and will never betray the trust of her commrades.
    History: One of the highest ranking warriors of the Kage-Ryu Dragon Clan, and it is rumored that she is the heir of the ancient Dragon Lord Ryushin who once reigned over all of the dragon clans. But since that time the Dragon Clan has broken up into several small factions and live in various places across the globe. Roku's father went missing after a battle with a group of vampiric warriors (wether or not he is actually dead is a mystery...) and she therefore has a personal vendetta against all or most vampires. She came to the city of Pernicious in order to search for clues about her father and to help quell the vampire uprising.
    Allegiance: Demons
    Other: ermm...I'll get back to you on this one....too tired...

    Roku Veradim:
    ~~~~~~~~~
    The darkness...ah, yes! The darkness was a welcome sight to me! When the daylight faded and the sun ducked below the neverending horizon, the creatures of the night would come out to play. It was at this time that I could shed my human mask and take back my true form...my demon form. And I definetly felt more free and empowered when i was not donning my human shell.
    "Ahh! That's better!" I sighed as I changed back into my demon form. I stretched out my wide red dragon wings and beat them twice, stretching them out after the long day of them being concealed.
    As I stared out into the darkening streets of Pernicious, I could sense that all, or at least most, of the humans were gone, and were now hiding in the safe refuge of their homes. It was just as well...it was not them that I was after....
    I looked around and tried to pick up the scent of any vampires that might be nearby. I was disappointed when I couldn't find one. But they would come...sooner or later. They couldn't hide from me...not for long anyway. I was determined to rid this city of each and every vampiric evil. And then, once my revenge against this race had been achieved, I would be able to find my father...


    **Winner of the "Most Mysterious Character" Award (2009)**
    Sanya Halvacor - Kingdom Heartless


    Kuro's quote fav:
    "Take whatever you want, just don't headbutt me." - Bear

  4. #4
    :3 Master Trainer
    Master Trainer
    Bulbasaur4's Avatar
    Join Date
    May 2000
    Location
    A Small Cardboard Box
    Posts
    6,105

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Name: Dhaeraow (Means, "traitor" and that is what most of the population upon the demon side calls her. But her real name is "Perya Morwen" Which translates to, " Half Daughter of the Dark" )
    Race: Half human, half demon (pure shadow demon)
    Age: Unknown - her appearance is mid-twenties however.
    Looks: http://www.megatokyo.com/extra/broken_miho-full.jpg
    Just like that (above!) She even has the strange, metallic looking wings but they can fold up so nicely that no one sees them. She looks like that but wears different clothing. She wears a tight, black tank top which is strapless, and below that she wears tight black, almost leather-looking pants but they are not leather and are very flexible. She wears boots like in teh picture, except they are light weight and not as clompy looking. She wears black, finger-less gloves as well, and around her neck is a silver chain with a strange symbol pendant upon it. On the back of her shoulder blade is another symbol- a tattoo in black, but she herself did not put that on her. She was born with it and has yet to figure out it's meaning. She also usually wears a black cloak which ties around her neck upon her back, so it covers her pressed wings (but they are hidden underneath her tank and she doesn't use them much.)
    Abilities: She has a strange ability to be able to have an uncanny prediction or 'feel' for things- sort of like being lucky and being able to read auras. She's very swift and agile and has natural simple fighting ability as far as movements go. She can also summon her shadow side to blend into the shadows for only a limited amount of time.
    Personailty: She's very quiet, doesn't like to talk much. Rather is shy and doesn't like to hang around other people... or creatures. She's been outcasted all her life because of what she was born as, and thus she has learned to stay away from others. You'll find out more... but deep inside, she's caring and innocent. The life just tainted her.
    History: She was born to a human when a demon, a pure shadow demon (dun see many of those now adays..) was near death by an attack. In her last fatal attempt to keep her race alive, she sent part of her own 'parts' if you may, into the female human who just happen to be near the area of the demon's death site. THis impregnented her, and when the human mother gave birth she was utterly petrified (also confused in how she was pregnent). Out of her disgust, with out telling anyone, she threw the baby into a trash can in hopes of killing it (suffocation) and not having to worry about it.
    But the demon side in Perya allowed her to live... and after a petrifying wail, a passer-by human found her. He was a nice man and actually own a dojo where he taught many forms of Chinese and Japanese fighting techniques. He had money and so he didn't want to make the baby go through the pain of adoption... so he simply took her in. After many years, she grew up to about the age of what could be considered a mid-teen. It was then however, that the demon population learned of her spawn- and being a half breed is very bad and looked down upon. So the demons came and attempted to kill her and the one who raised her - but they only succeeded in killing the man. Perya however managed to cloak herself, and the demons left. She was devastated... and vowed to never be harbored by anyone agian. The rest of her life is unknown and a blur... but she lived and trained herself in the streets the rest of her life (till now) She's known slightly through the human population, and most demons have had wind of her- but none have caught her yet.

    Allegiance: Indifferent
    Other:




    Dhaeraow (Perya Morwen) - F - Demon/Human
    "*8*"*8*"*8*"



    Why is it that when the dawn fall and the night rises, I never can get any time to myself? Why must I always be the prey... constantly chased by either my halves or the one who hates both?

    I nimbly jerked to my right, dashing away from the night air of the street lamps down the dark, wet and hardly-used street. Turning right into an alleyway, I dashed through it. My persuer followed... and I could hear is light, airy footsteps following mine. I knew the city well... and I would never be caught going into a deadend... but my persuer seemed to be extremely skillful in the art of tracking and taking down. Never before had I encountered a demon or vampire which persued me so skillfully... usually I could lose them easily. Occasionaly I battled and disabled them, but this one I sensed could bring some harm... and I wasn't into the mood tonight.

    But he was.

    My long, dark violet hair rippled in the wind as I scanned the dark alleyway ahead of me... many shadows. I was beginning to feel a bit faint from running, and I knew that going on like this was not going to shrug this guy off. He was a vampire... he reeked of teh stench of one. I never had much against vampires- well, I mean I never had much against them which led to more than demons or humans. all three species persued me. The humans and demons persued me because I was the symbol of both of them combined- some thing that will never and should never be crossed. Humans hated the idea of them intermixing with demons, and to demons it was a sign of weakness. To vampires? Well, they hated demons and humans... so their noses sensing my blood tainted with both probably made me a valuable victory or slaughter.

    Why is this one so intently upon me? I thought... usually most gave up by now. He must really enjoy the chase.. I narrowed my eyes, and quickly entered the darkest, shadowy part of the alleyway. My green, startling cat-green/yellow like eyes instantly began to glow and stand out eeriely like a haunting light. As soon as my body became emerged in the darkness, it began to grow almost transparent- blending into the surroundings of the darkness. My eyes instantly stopped glowing, and matched my body with the dark-like quality. I quickly stopped running and pressed my back hard against the shadowy alley wall. Gazing at my persuer as he came at me... I slowed my breathing so that it was not detectable. Standing there I consentrated.... a skill such as shadow cloaking was some thing anyone could not do for very long.

    My persuer also slowed down, and I saw the distinctions upon him instantly. His face was pale... common, and his nose was rather long and pointed which I found common amongst most vampires. His eyes gazed about with their dark, black-pitted pupils as he scanned about him. The alleyway was dark, but I knew he wasn't dampered by the darkness... but still, to see a shadow in a shadow was merely impossible- I ionly hoped he thought I kept moving along.

    His light, almost blonde, long hair rippled in his movements, as he stood there... walking slowly, and then stopping only a few feet past me. My head was getting dizzy... and a burning sensation was filling my soul points- my wrists, behind my knees and my neck along with my head. My fingers began to twitch, as he stood there.... and never moved. He wasn't being fooled...

    I knew if I stayed like this... my body would only be weakened, and easier to tackle when my body could no longer hold this state. I had to make a run for it...
    I with drew a breath, and then released my state of shadow quickly. It made no noise or light this time, and I dashed out behind him but the vampire noticed instantly. Whirling around, he with drew a gun and aimed it straight at me. I had little time to react... as he made a fire which was aimed at my leg. I was ready, and whirling around to face him I quickly leapt into the air.

    Aiming my booted foot at him, my shoe came in contact with his gun right after he fired and missed my blurred body. The gun whcih was in his hand riquocheted out of his grip, and landed many feet away. I landed in front of him, and in no time he unsheathed yet another weapon- this time a nice, long jeweled sword made out of some metal. I crouched upon the ground, and all of this occuring in seconds he swung at my legs. I flipped backwards, and he kept swinging. I had to keep flipping, until after many swings he grazed my boot, cutting off the front and slicing deeping into my foot. I winced as I took staggering steps backwards, my foot instantly flushed with warm, red liquid swirled with a mixture of strangely violet flecks. But this vampire came at me again... aiming at my legs.

    Why is he aiming at my legs? It's like he is trying to disable me. But why? I disable to get away... if he disables me, what for? Why not rather kill me?
    It was an action that confused me... but rather then dwell upon the thought, I withdrew my own weapon. Instantly a silver sword unshealthed into the air, and gleamed in the darkness with some uncanny glow. It was made out of pure silver... and encarved into it were many signs of the demonic language- but they were so ancient, even I did not know what they said. Still, it was a loyal and good weapon... and as the vampire thrusted his weight upon me with his sword, I blocked the blow and a clash of metal echoed through the air. I held to him, but he was far more powerful than I was. He pushed me backwards, and I had to quicky leap into the air to keep from falling. Regathering myself, I glared at him as he came at me yet again...

    I couldn't run away from this one, and with his ongoing of massive offensive attacks of power... it was going to be one hard battle to win.
    Here we go again..
    I thought, as he charged at me and I braced for impact, blood oozing from my now numb foot.



    (^^ Hope that leaves room.)
    [Please Send Tell]
    Video Games, Life, and the Random Objects You Trip Over

  5. #5
    Advanced Trainer
    Advanced Trainer
    Drusilla's Avatar
    Join Date
    Apr 2001
    Location
    Gateway to the West
    Posts
    1,930

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Name: Drusilla
    Race: Vampire
    Age: little over 100...
    Looks: Click the link in my sig....
    Abilities: Night vision, and she's excellant at reading Tarot
    Personailty: She loves death and destruction. Unless there's something in it for her, she probably won't do it. For example, ask her to do a favor for you... she'll ask what she'll be paid. Reply any sum of money, and she'll probably give you ten seconds to get away before she starts chasing you. Tell her she'll be able to kill a couple people, she'll think about it. Tell her she'll be able to kill as many as she wants, and she's in!
    History: Born a killer. She murdered her familly when she was young, and was left to the streets. She began to hang at the local vampire haunts, and when she was seventeen, they changed her. Ever since, she's been one of the city's finest mercenaries.
    Allegiance: She works with who ever offers her the much, but right now the Vamp ruler
    Other: Drives a black 2003 Firebird Trans AM, and rarely trusts anyone.

    post in the morning... i'm lazy


    [Annie] - Kurosakura says: Dru Dru, your RP's not rated M XD
    Drusie says: Oh fuck.
    Headbutting a car = not fun! says: It is now.
    -------------------------------

    3DS Code: 5300-9721-4472
    Switch Code: 1866-7493-0014
    PoGo Code: 5716-4300-0144
    Steam: Jessyrah

  6. #6

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Keruga'Vyorn
    -------------------

    The night was cool, a fresh breeze blew across the rooftops. Myseld and Sakea did virtually the same thing, leaping from one roof to another. Both in our demon forms we hd picked up the scent of a Vampire and were following it. Originally i had been hoping to run into Fal'ghi the elderly Shakou demon, "one of the best around till he decided to teach me everything he knew" i smiled to myself. He had been the first i met when i arrived in this city and had taught me well on how to avoid the eyes of the humans. Lessons Sakea should also know. There was another scent mixed with the vampires but it was hard to figure out what it was. There was a hint of fear in the scent, obviously it was the Vampire's chosen prey, and it knew it.

    We approached the source of the scent. An alleyway behind a store, closed for the night. Sakea stalked into the darkened alley and i leapt to the low roof. Slowly creeping ahead. As we approached the scene there was another creature locked in combat with the Vampire. The fight was not going well for the Vampire's prey.
    She stumbled and i noticed her foot was injured. The vampire kicked her hard in the chest and she slammed against a wall. In one movement i flipped down into the alley and drew my own sword. "Back off Vampire" i warned with a growl. A sound behind it made him turn and Sakea was stood, curved daggers in each hand. I had not seen those in a while. The Crescent Moon's as she called them, were swift, silent and deadly weapons. The vamp turned again and smiled baring its fangs.
    I bared my own fangs and readied myself "Lets dance"

    Afterworld ~ Chapter 2 | Blood Bowl ~ Chapter 3
    If nothing else works, a total pig-headed unwillingness to look facts in the face will see us through.

    ASB Record
    W-12 ~ D-2 ~ L-2

  7. #7

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Eh, hope this is semi-passable...

    Name: Farson Marrinor
    Race: Vampire
    Age: 42 (Looks to be twenty… at that age, he was changed)
    Looks: 6’3”, with a lanky yet strangely dignified figure. Hair is black with a deep brown tinge, semi-long, semi-wavy. Eyes are a piercing steel gray. Skin is pale, white even. Has a scar passing from the top of his nose on the right side to below his right eye. Wears black pants that are almost jeans… The material is fairly stiff, but not any sort of denim. Shirt is deep gray, --a “dressy” type of shirt that buttons/unbuttons. Over this, he wears a longish black suit jacket, usually unbuttoned, or only partially buttoned. In this manner, he appears both casual and formal.
    Abilities: The typical vampire assets… Increased ability of speed, of hearing, of sensing in general. His senses together allow him to perceive almost anyone from quite a long way off, and his speed allows him to move swiftly to defend or attack. Also quite skilled with blending into shadows and staying out of the eyes of those who pass.
    Personality: Solitary and somewhat distant from most. He searches the world to his own ends, for the most part, and believes that whatever happens has happened, and there’s not a terrible amount of use in worrying about it.
    History: He was bitten at the age of twenty, and has since been in evasion of most forms of life. He enjoys the vampiric lifestyle, but takes it as a loner and likes not to be in the large groups.
    Allegiance: Freelance
    Other: La la la…

    Farson Marrinor
    -----------------------------------------

    “Bloody humans,” I muttered, looking down at the street from the ledge I had reclined on.

    Pausing for a moment, I considered what I’d just said, then laugh shortly, with only a small amount of humor. Bloody humans indeed… That was why they were so very popular with vampires. Bloody.

    I needed blood. I hadn’t had any since the previous night, and to go without blood for very long was to ask for death. Sometimes the idea was a pain. I didn’t cringe when it came to killing; murder has never really fazed me, and it certainly didn’t pain me after I became a vampire. The death of a human wasn’t terrible. Mortal life, after all, never lasts very long. What did it matter to take the life? There was nothing for them to loo forward to.

    Sometimes I wondered what the point of being a vampire was. What was the point of immortal life if it was as pointless as mortal? This sometimes seemed true, sometimes didn’t. After all, being a vampire was different from being a human. Much was made easier, much was enhanced. Life could be what I wanted it to be. I was my own master.

    Perhaps not entirely correct. My Master was technically the one who had created me, but he had long since passed on. There had been no lesson learned from him; he had changed me and continued onward, leaving me to fend for myself. Because of this I had become what some vampires had called “improper”. I wasn’t human, but I didn’t quite behave as many vampires.

    Part of being a vampire--perhaps a large part--seemed to revolve around the mind and what it believes. An obvious point here was that I had never hated the sunlight. I certainly didn’t care for it, but I strayed not if I was out in it. Nor had I ever slept in a coffin; it seemed entirely unnecessary.

    There was much that I didn’t know, but no one had been able to tell me. Perhaps I was well enough off without instruction. After all, I’d been a vampire for twenty-two years, and there I still was. Even so, there were things I would have liked to have known.

    Much of what I wished to know revolved around the origin of vampires, as well as the rumors that I had heard from others of my kind… When they had been unaware of my presence. There were rumors that the vampire population was growing, that they wanted to wipe out all of the humans and demons. There were variations on the tales, but the basic idea was always the same idea of mass destruction.

    I couldn’t understand exactly why they’d do it. Apparently, the vampire I met couldn’t understand why I was not in support of it. Not all of them, perhaps, but most had obviously snubbed the humans and the demons. For the life--sub-life, pseudolife, death?--of me, I couldn’t understand this. Nearly all of them had, after all, been humans previously. Perhaps they all had; perhaps there was only one who had not.

    “Bloody vampires,” I mused, my eyes trailing over the sidewalk, catching vaguely the thoughts of those below, not paying much attention, only running over the mental voices subconsciously.

    Every species was just as f***ed up as the next, it seemed. Ah well. I personally enjoyed being a vampire in some way; the image was appealing to my mind, perhaps. There were points that could be bothersome, but mostly it was lovely in its own way. The sensations that could be felt alone made everything worthwhile.

    Looking into the deep sky, I stretched, then stood. It was time for me to find some sort of blood for the night. While I was searching, I could relish the night as I always did, could listen to the thoughts of others, could watch the shapes in the darkness. So alluring…

    Leaping from the ledge to the sidewalk several stories below, I landed among the crowd, though they did not see. If anything, they only felt the presence of another who perhaps had quickened speed to suddenly appear from the crowd behind them. Walking swiftly, I soon passed by these humans, cutting through the crowd easily.

    The night and everything about it was beautiful. Who could prefer the daylight? I could watch it, I could sit through it, but why bother? The night was more beautiful. The day was a wasteland, a horrid wasteland filled with bright hatred.

    The night was alluring. So very, very alluring.

    -------------------

  8. #8
    Banned
    Join Date
    Jan 2003
    Posts
    1,256

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Name: Ty'Lan Qui-Shi(Tie-Lan Kwi-Shee)
    Race: Phoenix Demon
    Age: about 2000-2100(see abilities)
    Looks: Tall, around 7'8, rather thin looking. His eyes are like birds eyes-round and dark, with black stripes and very small brow ridges, and his nose is hooked, like a beak. His face below his nose looks almost identical to a human, except his lips are thinner and quite hard. His skin is pale, but with a heavy red tint, and he has long solid red hair(not auburn, more like a darker solid red) that goes untamed down to his lower back. He also has the same color wings, making him look something like an angel rather than a demon. He wears a vest usually, red with black trim and apparently made of colored leather, open in the front, with holes for his wings in the back. He also wears red pants, average, not tight or baggy.
    Ablities: Not much really. Like a Phoenix, when he dies of natrual causes(old age, ect.), he burns into ashes and is then reborn from them, which explains his age. He flies very well, and his quickness, reaction times, and hand-eye coordination are far superior to a human's, although his strength is rather lacking. His sight is also far better than most others.
    Personality: Almost completely silent. He doesn't really like anybody, and it's rare that he even trusts anybody. He's very easy-going. However, he steps up when he is needed, and does what he has to to survive.
    History: Born way back when the vampires where still expanding. He's one of the few demons who remembers those times, and it makes him all the more desperate to stop this. Most of his life, he's done what most Phoenix demons do, just fly around, going with the flow, ect.
    Allegiance: Demons
    Other: nothing really

    Ty'Lan
    --------------------------
    Ty'Lan sighed. The sunset was incredible, and his keen eyesight made it even more amazing. The cold breeze blew his long red hair back and blew ripples in his clothes. He felt great, he was finally free. During the day, like most Phoenix Demons, he hid underground, his long red hair and massive height made him hard to disguise. In the night, he could do as he pleased. Right now, he sat on top of one of the buildings humans called skyscrapers, one foot on the ledge, resting his upper body on his knee, staring at the setting sun.
    However, with the vampire's new activity, he was always on edge. He rarely walked on the ground, where the vampires lurked. It may have been cowardly, but Ty'Lan didn't live for two millennia by not avoiding danger. In the distance he could see a pair of humans trying to fight off a vampire, one with a sword. A vampire hunter most likely. For a while, Ty'Lan watched, completely safe. I don't have anything to do with this. My people have lived for eons by avoiding danger, I have to do the same... he thought to himself, remembering the stories his parents told him of wise old phoenix demons who lived for tens of thousands of years, seeing much, knowing more. He wouldn't live to achieve that if he was always so reckless. So he watched, part of him straining to help. Still, the rational part of him understood that even if he did try, he would likely be killed, and for what? A pair of mortal humans who would probably die in 30 or 40 years anyway? Ty'Lan spread his wings to their full span, over ten feet, and flew off. However, as he flew, his mind was elsewhere. The vampires... Ty'Lan remembered when they were this offensive. Thousands of phoenix demons were killed just for a vampire's fun, including many of Ty'Lan's friends and family. The last time Ty'Lan saw a vampire was when he was hiding in a small indent in the sewer. He heard his friends' screams as vampires massacred them. Ty'Lan remembered the bloody pale face, gnashed fangs, looking for him. He remembered his horror, praying that somehow he wouldn't be noticed. Just remembering that made Ty'Lan's blood run cold. He shook his head. He would not let himself get sucked into this war...

  9. #9

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Ashram Marduk(Hammurabi to elder vampires)
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

    Ashram looked down on the city from his perch on its highest tower. No one could see everything from up here but he could see more than most. His eyes scanned the city for any signs of the demon hunters. It did not take long for him to find one but any hunter would not suffice. He had to send a message and for that, only the best among the hunters would do.
    He continued to look over the many rooftops of Pernicious for what would be his prey. There were too many hunters out for his taste on those rooftops. Most of them he could see to be young and weak but some were not so helpless. It was those that he would hunt tonight.
    He watched until he found what he thought to be a suitable target. One that moved with not only skill, but experience. That would be his mark, his example.
    He leapt from the tower and glided down towards his prey. It was nearly a mile away but that was an easy flight for someone like Ashram. It took only aminute to reach the rooftop he had targeted. With a soft thud he landed on the roof, announcing his presence.
    "Not very subtle," the hunter said, turning to face Ashram.
    "Tonight requires no subtlety hunter,' he replied coldly.
    "Doesn't it?" the hunter answered back with a slight chuckle. "Perhaps you haven't heard of me bloodfiend. My name is Fal'ghi. I believe you'll regret being so forward."
    The hunter unsheathed his blades as he took a step forward. He took another step forward. He hesitated then, pausing to examine his opponent.
    "It wouldn't really be sporting if you don't at least draw your sword," Fal'ghi said nervously.
    "That won't be necessary," Ashram said, extending his fingers out evenly.
    In a flash he flew forward with invisible speed. Before the hunter could even flinch Ashram plunged his hand into the mans chest. Before the blood could even flow Ashram had impaled the hunter four times with his pointed bare hands. Ashram took a step back and swiped his hand sideways.
    Everything froze for a moment but then a wide spray of blood spouted out from Fal'ghis throat. The huner froze there stunned, unable to move. He opened his mouth to say something but only blood bubbled forth. Finally he collapsed to the ground a mere two seconds after Ashram had first moved.
    "I would've expected more from such a reputable hunter," Ashram said flatly. "No matter though. You will serve my purpose quite well."
    Ashram hefted the bleeding corpse over his shoulder and leapt from the roof of the building. He fell the 15 stories and landed roughly on his feet. He found the nearest manhole and hefted it open with his free hand, tossing it aside like a pebble. He disappeared into its darkness with the body in tow.
    ~~~~~~~~~~~~minutes later~~~~~~~~~~~~~~~
    Many of the eldest demons sat quietly in their meeting hall. They had gathered to address the matter of the vampire population. They were waiting for the last few members of their council to arrive before beginning. By the time those members got there though there would be something else for them to discuss.
    Suddenly the double doors at the rear burst open and a body was thrown all the way to the front of the room, crashing into the wall. A dark form marched down the aisle after it, cold and intimidating. It made its way to the front of the room and turned to face the assembly of demons. Instantly they all recognized who it was.
    "I came to deliver a singular warning! The rise of demon hunters in the city above is unacceptable. I have gone to great lengths to assure that vampires have left your youth alone, to make sure that my kind does not prey on yours. I suggest you do the same. Put a stop to all hunter activity or this fools fate shall befall every last hunter you send into the streets above!"
    The room hung in silence. Many wished to say something but most were unable to find the words. Finally one of the demon elders rose.
    "You can't expect us to keep every...." just as quickly as the elder had stood Ashram had charged his place in the back of the room from the podium in front.
    His words were cut short as he found Ashrams straight hand piercing through his throat. Ashram withdrew his hand and the demon elder gurgled blood as his form slid back to his seat, motionless save for the flow of life fluid.
    "I can expect whatever I wish to. Would anyone else care to question my orders?" Ashram said with frozen hatred.
    No one else thought to stand or say anything. Ashram held his hand, coated in demon blood, up for the assembly to see. His wicked smile was small but visible. He stared over the demon assembly, giving anyone else a chance to object. No one did though.
    "Very well. Remember my words demon elders. I will not permit my kind to prey on you but disobey me and I assure you I will command them to wipe your seed from existance!" Ashram paused one more moment.
    He let them all soak in his words and his malevolent presence. Finally he turned and exited the way he had entered. He disappeared into the darkness of the world below. He had given the demons much to consider.

  10. #10
    A serious brain-f*** Advanced Trainer
    Advanced Trainer

    Join Date
    Sep 2002
    Location
    The "awesome" accents factory
    Posts
    2,408

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Name: Sam
    Race: Vampire
    Age: 20 in human years
    Looks: clicky
    Abilities: Agile, stealthy and has a good sense of hearing
    Personailty: Very aggressive and arogant. He's not a social person and will avoid contact if possible. Loves to see others suffer. A loner who follows his rules his way, no matter what anyone else tells him.
    History: He was abandoned as a child, people believe this is the reason he turned out the way he did. He was only five when it happened and he didn't understand why. He became enraged and began to wreak havoc and destruction. When he didn't get very far he moved to Pernicious and began a killing spree. For five years he murdered the citizens of Pernicious and was never caught, until one day when he was caught comitting the murder. Whilst he was making his escape down an alleyway he was jumped by Vampires. By the time the cops caught up he had already been changed.
    Allegiance: Vamp ruler supposedly but kinda freelance too
    Other: carries a sword with a long blade

    Sam
    ~~~
    I smiled as I kicked the lifless body off of the roof. Vampires are supposed to hide the bodies of their victims but not me. I like to display it where everyone can see and this street is perfect. Although deserted now, it would be packed with people tomorrow.
    I took out a small cloth and cleaned the blade of the knife. Of course, to avoid getting punished from breaking a vampire law I make it look like a murder, a stabbing.
    I put the knife away and made my exit from the building, scanning for my next victim.
    I heard the clashing of blades as I passed and alleyway. It sounded tempting so I headed over.
    A vampire was fighting against two demons, feran emons if I'm not mistaken and beside the wall, a human-no. Half human half demon, very nice indeed.
    I quickly decided to 'assist' this over vampire, I'd make off with the girl afterwards, a half-demon, half-human would be a nice catch.
    I drew my sword and entered the alleyway.
    "Two demons on one vampire? Are you really so weak that you need to gang up on us now?" I questioned.
    The two demons looked at me, only now becomming aware of my presence.
    I walked over to the other vampire. "I'm gonna evn the ods a bit and muscle in on this fight."
    I looked at the two demons and held my blade in front of me. "Bring it on."
    WANTED:

    One signature.
    Experience preferred although training will be provided.
    Witty slogans only, please.

    Imooto-deshi says:
    "BEEEE A ROUGE TOMATO"

  11. #11
    :3 Master Trainer
    Master Trainer
    Bulbasaur4's Avatar
    Join Date
    May 2000
    Location
    A Small Cardboard Box
    Posts
    6,105

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)




    Dhaeraow (Perya Morwen) - F - Demon/Human
    *^8^*^8^*^8^*


    As my back hit the hard slabs of the concrete wall, I felt a slight pain shoot up my back. My vision blurred for a fraction of a second, but instantly the demonic blood with in me set the vision correctly and I could see easily once again. My hair was strewn about in my face, as my eerie, starting cat-like green eyes opened and narrowed at the vampire figure. When our swords had clashed… he had pushed me backwards… and now he was walking forward. I saw my opportunity…
    I pretended to be severely injured, wincing horrible and falling myself to the side to act as if my spinal cord had fractured or enabled me to move. I remembered how it still seemed extremely strange that this vampire didn’t go for a kill… it was as if he was trying to disable me- but why? Vampires aimed to kill… why would he treat me any different than a normal demon or human prey? It didn’t matter however… he would not capture nor kill me. As he came forward, I could tell in his walk he was confident he had hurt me enough so that I couldn’t move… and the old, ‘injured wing’ trick was working. As he approached closer, I waited to leap upwards… and then stab him straight in the chest near his heart and tear it through… a move which would require all of my speed- but it did not work.

    The reason was simple- interference. Suddenly two shadowy figures leapt from the sky above, and landed. One in front of the vampire between me and my pursuer, and one behind the vampire had landed. The recognition of what they were stabbed me and pierced through my mind easily… it flared up with in my mind at the recognition of my own half blood- demons. It disrupted everything… sure they could probably take on one vampire and it would help me, but then it would be me against two. They were demons… and demons did not take kindly to a half kindred. There was only one half kindred… and that was me. I kept with my act however, and still let my body lie motionless on the hard cold ground. The demons moved in slowly upon the vampire who was quite shocked… but then yet another figure joined the party. A vampire came into the middle, landing next to the one w ho had pursued me. This vampire seemed a bit more cocky as he smirked and gazed at the two other demons and spoke, “Bring it on!”

    I watched, as the demons and the vampires exchanged a mixture of blows. My eyes watched fasinated... as I kept pretending with my injury. I watched as the demon who seemed more female was sent flying into a group of trashcans by the older vampire (the one who had chased me here), but as soon as she hit the trash cans, she seemed to leap back up and head right into the action. The male demon was skillful, but the new vampire had lashed at him… and the demon seemed a bit rusty in his techniques. Still, he was skillful enough to hold his ground…
    They’re fighting… they probably don’t remember I’m here anymore.

    It was a perfect opportunity to get away.

    I had no attachment to these demons who decided to leap into this… perhaps they wanted just to kill a vampire- or maybe they just wanted to kill me too. What ever the reason, I wasn’t about to be held at the mercy of vampires or demonics. I slowly raised to my feet, and pretended to stagger incase any were watching… and then as soon as the demons and vampires clashed together again in a beautiful display of fighting techniques, I dashed off down the oppisite direction of the alleyway.

    It was a dire move… a move to get away that could easily fail and rarely succeed. I could only hope they were distracted enough to not pay attention… but after a few free seconds- perhaps 20, suddenly a shadowy figure leapt in front of me. I stopped immediately, sliding to a halt and immediately sensed the evil intentions among the figure. It was the vampire who had pursued me earlier… the one who would not let me get away. For the first time, he spoke to me… his voice dry, battered and rather gruff. Blood dripped down his face, as his chest rose and fell as blood drenched his clothing- the demons must have cut him up badly. But he was still able to survive…
    I gazed back quickly, to see the two other demons attacking the one vampire who remained behind… and they were held busy by that vampire before able to perhaps attack this one who had pursued me if they wanted. I glared at the vampire… as he smirked and spoke..
    “ I… am not allowed.. to let you … get away..” He breathed heavily, and I quickly charged at him hoping he was weakened enough. But he still had strength.
    He pushed me down to the ground with a swift kick to my chest, which caught me straight and knocked the wind out of me. I quickly rolled onto my stomach and tried to crawl up upon my feet again, but instantly I felt his hands around my waist as if to pick me up. I clawed to get free, scurrying to get loose and I was getting out of the grip of his hands… and he knew it. So instantly he tackled me to the ground, as I felt him reaching for some thing in his pocket as if to bind me as his hands seized my neck and his body weight pressed me to the ground.

    I gritted my teeth, and knew I couldn’t move…
    But yet… some thing could…

    I felt the metallic presense upon my back, and knew they were strong. The one thing that was not commonly known… or rather, the one thing I never understood was why they were made out of metal. Demons did not have metal built into them… humans did not either- but for some reason, the gift of metallic wings were placed upon me. And they were as sharp as daggers if they were to open abruptly and you did not get out of the way…

    A howl of pain screeched into the air- extemely louder then I thought he would cry out- but it was cut short as blood gurgled into his throat and soon his cry was cut off as he could no longer breath, and then died. My wings had abruptly jerked upwards to my summoning, and spread out widely and straight upwards like a butterfly flipping it’s wings up… but my wings were deadly sharp at the tips. The tips of my wings… metal-like feathers, had sliced clean into his chest in multiple places and I knew that one of those places were in his dead heart. Even a vampire couldn’t survive that… along with the length in which my wings had entered his body which was quite deep.

    His body was limp… and I felt his hand go cold around my neck, and soon I had scrambled from underneath him, my wings caught with in his bones and his flesh, but soon I jerked hard and my wings came loose from his body. I panted heavily, as I walked away… a faint limp in my walk as blood still was damp with in my foot. Gazing back, his dead pale body was upon the ground… blood spilling the area. I could feel his blood was upon my back as well… small streams of thick liquid blood running down my metals wings, oozing like some slime. I kept my wings spread outwards, so that the blood that dripped would land upon the ground. Flecks of blood were in my hair and face as well, but I did not care. My eyes were their narrow, melonchally gaze again… as I looked at the demons and the vampire to see what they were now doing…

    [Please Send Tell]
    Video Games, Life, and the Random Objects You Trip Over

  12. #12

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Samchu: Your last post is not accepted. It is not generally allowed to either power RP or make another player's character look stupid. You managed to do both in your last post. Please delete it immediately. If you wish to include other peoples characters in your post you need to show them proper respect. How many well trained and experienced hunters do you know that slip in the rain? Consider this warning number one. Three strikes and your out of the rpg.

  13. #13
    ~HOPES AND DREAMS~ Elite Trainer
    Elite Trainer
    Asilynne's Avatar
    Join Date
    Sep 2002
    Location
    Between tomorrow and yesterday
    Posts
    3,915

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Name: Brandy Summers

    Race: Vampire

    Age: 24

    Looks: Dark reddish brown hair, light green eyes, 5'8", 130 lbs, usually wears a black shirt with the hospital logo on it, black jeans and a white labcoat. Sometimes wears glasses, though she doesnt need them, theyre just for 'show' ^-~ also has black gloves that she uses when shes working

    Abilities: basic vamp stuff, night vision, good sense of smell, aura sensing, the usual

    Personailtyomewhat bitter, but very determined, seems to be cold at times but mostly is just a bit anti-social. Wants to help people because it was her dream back when she was human, but now she pretty much does it to keep a part of her humanity intact. She doesnt want to lose herself to the monstor shes become. Usually tries to keep her distance from people, fearing that theyll either find out what she is or shell lose control and start killing people. Has a very strong will.

    History:Was a normal high school student until the night after graduation she was coming home from a party and got bitten and changed. After realising what happened she refused to accept that her life as a human is over and started taking night classes at the local college to get her doctors degree. Met her husband David when she was walking home from Pernicious University late at night, he offered her a ride since the city could be dangerous at night (she found that out the hard way in high school LOL) and things went from there. At first she resisted getting involved with anyone due to the nature of her species, but eventually fell in love with him and they got married. Has kept her secret under the guise of a very rare and mysterious disease called Xeroderma Pigmentosum (or XP), which is an inherited skin disorder that impairs the bodys natural ability to repair skin cells damaged by Ultraviolet light. Any contact with sunlight causes anywhere from mild sunburns to pain and blistering upon immediate contact with sunlight. It affects not only the skin, but the eyes as well. Coming across this disease one night in a Medical Journal, she has used it as her 'cover story' ever since she was changed. Hasnt even told her husband the truth for fear he would loathe the creature she is. She works the night shift at a local hospital, as an expert in human Genetics. Lives to get revenge on the vampire that changed her, and also to someday find a way of reversing the genetic affects of Vampirism and lead a normal life as a human.

    Allegiance: Freelance

    Other: Not much is known about the disease that is her cover story, so no one has really questioned it. Oh and one more thing, shes not happy about being a vampire and because of that and the fact that she wants to hide what she is, she rarely uses the abilitys vamps have, unless someones life is in danger or its absolutely needed.


    ~~Brandy Summers, MD~~
    Genetics Lab II
    ::hortly after nightfall:::
    ATTCTGAAAGCCTCGCCTAATCGAGAGCTCGATTCAGCTAGCGACGATCG ATCGTAGCGACGATACGAGCACGATCGATGACGTCGTCAGCGAGCACAGC AGCATGCTAGCTACGATGCGTAGCATCGCGAGCAGCGTTCTAAAGCTCGG GTCATAA
    I squinted my eyes as I studied the computer printout of the section of DNA I was working on. Nothing.....NOTHING!!! Everything looks perfectly normal, where did human DNA end and Vampire DNA begin? Where is the point that the DNA has been altered?! It was so frustrating, every night was a disaster, every night was another dead end. I was no closer to finding the answer than I was a year ago.
    Vampires. To some, no, really to MOST, that was a laughable idea. Imagine, dark overlords of the night swooping down to feast upon helpless humans going about their innocent lives. Indeed, a laughable idea. To MOST.
    TCCGAGATTCGATCGGATCGGCTAGTTTCTGTGCTGTGGCATCGATCGGG CGTATCGACTGGGCGCTACTATTACTGACTGATCTTCGGTATCGGCTAGC GACTGCTGACGAAGCGTAGCTACGGCGGCGGACGGACGATTCGCGATCGG CGGACGCAGCGTGAGCGATCGCGAGCGATCGGCGAGCGAGCGAAGGTCAG CGCAGCGAGCGAGTTT

    But I knew better. I knew Vampires were all too real. I knew that vampires didnt care whether or not a person had dreams, whether or not a person just graduated from high school, and was about to embrace the world and really begin their life. Vampires didnt care if you wanted to have a husband and a family one day. They didnt care if biting you and turning you into one of them would make every day of your life a living hell. I knew that all too well.

    ATCGACATCGGATGCTATCTATATCGATCTGACGTTCGCCGCGATCTACT TAGCGAGCACAAACGCGACTTCGAGCAAGCGACGACGGATTCTATCAGCG ACGGAGCAUCGATG-------

    Wait a minute.....U?!

    "Dr. Summers!"
    I jumped, startled, and instinctively looked up at the person who called my name, losing my place in the process. Frustrated, I took my goggles off and threw them across the room. "YES! What IS it?! I was just BUSY THATS ALL!!"
    Dr. Lombardi shifted her weight and sighed. "Im sorry for disturbing your work Brandy. I was just showing the new medical examiner around. Dr. Lancaster, this is Dr. Brandy Summers, head for Human genetics."
    I looked at Dr. Lancaster, who reguarded me with a strange look. "Rather young for such a prestigious position, dont you think?"
    Dr. Lombardi laughed. "Dont be fooled by how young she looks. Though she looks like she just got out of high school she actually has taken 6 years of medical school plus private study. I wish I could keep my youth like she does!" She said the last with a laugh.
    Dr. Lancaster looked at me again. Something about that look I didnt quite like, but I couldnt place what was wrong with it. "Quite." He said. I was starting to feel dizzy, I started to sway from side to side. I almost fell over....but then Dr. Lombardi's voice brought me back to my senses. "Brandy...your not looking so well. Why dont you take the night off? Youve been working non stop for days....I bet your husband misses seeing you. When was the last time you and David went out just the two of you?"
    I nodded, knowing she was right. I really did need to take a break. Smiling I grabbed my coat. "Thanks, I think I will."
    As I left I felt the eyes of Dr. Lancaster still on me.....

    ~~~~~~~
    ~~~~~~~

    Before I left though, I needed to take care of something. I was very hungry. Going into the bathroom I pulled a plastic container out of my purse and opened it. It was blood, and though I hated being a slave to it, I needed it to survive. I grimaced as the cold thick liquid flowed into my mouth. My instincts told me the blood should be warm, and full of life. Well that was just too bad...

    ~~~~~~~
    ~~~~~~~


    The sewers spewed steam as I walked down the city streets the 5 blocks to the apartment where David and I called home. On the way there I thought about what I hoped to do. I had to find a way to reverse the effects of being a vampire. Then I wouldnt have to hide in the dark, lie to my husband, drink blood.....
    Suddenly I stopped. Blood. I smelled it. It was fresh. I turned my head to look into the alley I was passing and saw a body there. Looked freshly murdered. My instincts were crying for the fresh warm blood oozing out of the victim, someone killed it just for me it seemed, knowing I was hungry....
    A thrill of panic went through me. NO!!! Im human!! And Im gonna stay that way!!! In a panic I ran from the area, leaving the body, the scent of blood, and my hunger in the dust. I didnt stop running until I flung open the door to the penthouse and slammed it after me.

    David heard the noise and stood up hurridly, throwing his book down. "Brandy! Honey whats wrong?! What happened?" He put his gentle hands on my shoulders trying to calm me down. But what could I tell him? "N...nothing. It was just...a shadow startled me. Ive been working too hard..." I hated lying, it seemed like thats all I did. I turned my head away. I managed a weak smile and kissed him on the cheek. "Im ok, really."
    He looked at me for a minute, then smiled. "Well, next time you get off work early, try calling me to pick you up. Its better than sprinting down the streets at night." He said, giving me a wink. I smiled and hugged him. While he couldnt see my face I frowned sadly. I wished I could tell him, tell him everything. But I couldnt, ever. I couldnt let anyone know what I truely was.

    That the thing I was really running from was myself.
    ~~~~~~~~~~~~~~~~~~~~~

    Hope thats ok for introduction post! ^-^




    .: Ben + Brandy :.
    .: September 14th 2012 :.



  14. #14
    :3 Master Trainer
    Master Trainer
    Bulbasaur4's Avatar
    Join Date
    May 2000
    Location
    A Small Cardboard Box
    Posts
    6,105

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)


    Oh, I drew a picture of my half demon/human char. It isn't anything special... I drew it quickly in biology while listening to our teacher go over some stupid notes before we had to leave. Go here to see it:
    www.angelfire.com/crazy/shweet/drag.jpg


    Name: Tella Me'arauko (Means, "Last Light Demon" <- the name she gives herself. Her true given name at birth is Martye Coia tel'tehtar, which means Destined Life of the Signs)
    Race: Light Demonic Being ( The last of her kind... here's the scoop. In the beginning of demons, there were actually two forms- the ones today, known as the dark demons, and the light demons. They were virtually the oppisite of each other... and did not take a liking to each other as well. Then when the vampires rose to power, and organized the government which all demons and vampires know of today, the light demons refused to join. They refused to go under the rule of the vampires quest for dominance.. .and because of t his, the vampires and the dark demons slaughtered the light demonics until they were wiped out completely- accept for one, Marte Coia tel'tehtar. The has happened so long ago however... that none remember it, except for the ancient of vampires... VERY ancient vampires...)
    Age: Unknown
    Looks: Attached in attatchment below! She looks just like that, especially when she's about to transform. When she's hunting, she wears those clothing some times... but in the regular day, she wears light blue jeans which are stretchy and soft, along with a white tank top with thin straps to hold it up. She has silver earrings with in her ears, along with light brown sandals which fit to her feet and do not come off as easily as other sandals. Her hair is usually down during the 'resting' hours, and she has a tattoo around her wrist of a white wolf, surrounded in whispy smoke. (the tattoo itself is very small.)
    Abilities: She has the ability to transform into five different animals- wolf, horse, hawk, cat and the last one is unknown. All of these transformations however, have one very distinct thign in common- her forms all all albino with crystallic, icy blue eyes. She's also extremely fast and agile. She also can stay in the daylight- an adaptation which makes her different from modern day demons. Light demons are built not rather for fighting more less are more peaceful... at least, they used to be until they were killed off.
    Personailty: Very quiet, she does not talk very much unless she needs to or when she does her voice is soft and rather down-to-earth. Her expression is always like it is in the photo (below), but a little deeper in thought as if always thinkingto herself. She's full of guilt about the past and pain from it... and it takes a while for her to truely trust those whom want to be her friend. She's kind and not cruel, but it takes a while for her to warm up to people.
    History: She was born when the Light Demonics still existed, and was raised by their inner clans. When the war broke out, and the light demonics began to dwindle... they sent her into hiding, where she hid and trained herself until the war wa sover and her species was nearly extinct. She remained 'low' for several hundreds of years... until finally she reimmerged into the modern streets when the humans now existed. She's been living among them, avoiding contact with demons and vampires a like, but during these modern nights and days she's becoming to realize she can't hide anymore.Little else is known about her.
    Allegiance: None
    Other: She has a metallic sword, which is thin and nimble yet beautifully crafted from ancient times. The handle is made otu of an unknown jewel, clear in color yet swirled in the inside with inner whisps of violet and cyannic blue. The blade of the sword is also clear, but the inner swirls mixed inside of it are a light shade of eerie green and cyannic blue. Carved into the sword are light demonic symbols... which are unknown to what they say but they are simmilar to the figure of a wolf- just more symplistic. Another thing about her, is that light demons are fast but they have a very serious weakness- they stand out. Unlike the demons of today, her kind stand out to any species. Whether she's in a crowd of people where you can barely see her or alone in the streets, she stands out like a beacon. Some thing about her always attracts attention... which makes it virtually impossible for her to hide or try to blend in if she's trying to avoid some one.






    Tella Me'arauko - F - Light Demonic
    ***

    The dark has fallen...
    I thought slightly, as I sat upon the rooftop, dangling my legs over the edge slightly. The moon showed itself once again... and I gazed at it sadly. How many years had it been since that moon rose... and everyone had fallen? Everyone... and I had been alone?
    Too many to count... far too many, more then I wanted to recall...
    I took out my sword, and watched as it glistened in the moon's light, still sitting upon the edge of the rooftop upon one of the largest skyscrapers in the city. No one would see me here... unless they were looking for me, or happened to want to climb the tallest buildingin the city- which was highly unlikely. Gazing at my swirled sword, I sighed... remembering the time when the sword wa some one else's, and not mine to touch nor look at. But they had given it to me before they died... and now I was the last to wield it.
    The smell of blood was upon the air- but it was that way every night. Even high up into the night sky I could smell it... and it was disturbing. Mixtures of human blood... but occasionally it would be vampire, or even demonic blood as well. The slaughterings which occured each night... which only went away when the day time came.

    Even though the day time was not harmful to me, I prefurred to sleep at day. I never felt comfortable to sleep during the night... there were far too many things lurking in the shadows for me to ever feel safe to sleep in a bed at night ever again.
    For they will always be lurking...
    Shaking her head, she continued to gaze at the moon... pondering about how many more y ears it would be before some thing decided to give in the world... whether either the humans would perish, and the vampires would conquer... like history repeating itself, or would some thing else...



    [attachment deleted by admin]
    [Please Send Tell]
    Video Games, Life, and the Random Objects You Trip Over

  15. #15

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Keruga'Vyorn
    -----------------

    The Vampire had attacked, swiftly and showed much skill in his style. He seemed intent on me and Sakea hung back incase she was needed. Without warning a second figure jumped from the rooftops around us and joined the fight.
    After a little taunting he too began to attack, focusing on me our previous opponent had decided to attack Sakea. "Sorry bud, you wont get an easier fight over there" i smiled to myself as he narrowly avoided being decapitated by the crescent moon's.
    I focused back on my opponent, manuvering around Sakea's battle was now behind me.
    My opponent was good and as it began to rain he seemed to be aiming his attacks low, causing me to improve the speed of my footwork. "If your hoping for a slip you can forget it, im not just a hunter, im a cat too" i grinned. He swung up violently and i took a bad cut to my side. I spun from the blow and kicked him harshly in the gut as i roared with pain. Leaping high i planted one foot on the wall next to me and used it to spin high, connecting with the side of his head with a viscious kick. He span away into the alley and was lost in the darkness.
    I turned to help Sakea but she too was unconcious against the wall. The Vampire and his prey had moved on. A scuffling followed by a loud scream came from round the corner. I followed the sound to find the Vampire with numerous wounds. The woman stood there with metallic wings dripping with blood. The vampire was down, unconcious but alive wit h numerous wounds. I was about to raise my sword to end the job when i heard another blade being unsheathed. It was the woman, a demon of some decription. She wielded an elegant weapon, a slim silver blade that shone even in the darkened alley. I stepped back, allowing her the kill and with precision the blade whistled through the air before cleaving the Vamp's head clean off.

    "Are you ok?" i asked as she dropped to one knee, the injury to her foot evident. She simply looked at me with venom in her eyes, as if she now decided i was to be a foe. I stepped back but she did not move so i went to check on Sakea. The Vampire i thought i had dealt with was approaching her unmoving form. I drew my gun and fired one shot directly ahead of him, causing a 'stitch' mark on the wall. He turned and hissed at me before dissapearing into the night. I did not know why i had spared the evil creature but i pray it would not come back to haunt me. Either way i would not be so mercifull next time. Clutching my side i knelt beside Sakea and tapped her face. Unconcious she had once again changed to her human form, a defence mechanism Feran had developed. Should we fall asleep or become unconcious in our demon forms our bodies automatically changed, much better if a human found an unconcious human than a Cat beast.
    I lightly slapped her face and shook her shoulders. "Hey" i said softly with a slight worried laugh in my voice. Her eyes fluttered open. "Guess i really am gettin rusty" she groand as she rubbed her head. "How'd we do?" She asked.
    I smiled as she looked at me. "We won i guess, for now. One vamp ran, the other is meat"

    Afterworld ~ Chapter 2 | Blood Bowl ~ Chapter 3
    If nothing else works, a total pig-headed unwillingness to look facts in the face will see us through.

    ASB Record
    W-12 ~ D-2 ~ L-2

  16. #16
    Banned
    Join Date
    Jan 2003
    Posts
    1,256

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Ty'Lan
    ----------------------
    Ty'Lan just flew. He wanted to wear himself out completely, to leave his thoughts behind... But he couldn't. Something urged him to fight, a deepset instinct that told him that what he was doing was cowardly. Still, he didn't do anything. The two forces raged within him, his instinct, which called him a coward repeatidly, and everything that he was taught in his life, which told him to play it safe, that he was doing the right thing. After all, the elders, some who were over a hundred thousand years old, knew best... didn't they?
    Disgusted at himself for his questioning of the elders, he dove toward the ground full speed. Normally, Ty'Lan would have found this exhilerating, but he couldn't, not with the war inside him. Suddenly, an idea sprung inside of him, causing Ty'Lan to pull out of his dive. Elder Michizu'Yu. He had always helped Ty'Lan through his problems before, hopefully he could help him again.
    I should be going back anyway. The sun will be up in under an hour he thought, floating down to the ground, entering a sewer. This was always the worst part of the day for Ty'Lan. Walking the sewers after a night of freedom, reduced to hiding in the bowels of the city. Still, there was nothing else he could do. He entered the underground through a crack in the sewer wall. The ancient tunnels stretched out before him, but Ty'Lan knew what to do. He walked almost endlessly, until he reached an open cavern. Here, in the semi-darkness, sat Elder Michizu'Yu, studying a massive book, written in strange runes Ty'Lan couldn't recognize.
    "Young Ty'Lan. What brings you to me? Much conflict, I sense in you..." he muttered softly, not even taking his eyes off of the huge tome.
    "Yes sir. I have come to ask for your guidance. Tonight when I was flying around the city, I saw a vampire hunter battling a vampire. I don't know why, but I had a sudden urge to help, to attack the vampire..." Ty'Lan started.
    Michizu'Yu looked up, looking suprised, pained, and even a bit pleased. Ty'Lan looked at him blankly.
    "I knew this would happen some day. The warrior blood in you is causing much confusion..." he said, suddenly turning to the tome, searching furiously for something.
    Questions popped up in Ty'Lan's brain like crazy.
    "Warrior blood? But I thought we were a peaceful people!" Ty'Lan exclamed.
    "That's what we want you to believe. We never told anybody why the vampires were so bent on killing us during their last uprising. Children, like you, are brought up believing that because it was part of our peace treaty with the Vampires," he said...

    OOC: I'll finish this tomorrow, it's late... must sleep...

  17. #17

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Ill let it go this time DarkTemplar but next time try not to rush the time on too fast.
    Incase you didnt notice theres a whole thing going on that will take time to resolve and any Vampire char's are gonna have a hard time posting when the sun is up.

    It can be worked around this time i guess just be a little more considerate.

    Afterworld ~ Chapter 2 | Blood Bowl ~ Chapter 3
    If nothing else works, a total pig-headed unwillingness to look facts in the face will see us through.

    ASB Record
    W-12 ~ D-2 ~ L-2

  18. #18
    Advanced Trainer
    Advanced Trainer
    Drusilla's Avatar
    Join Date
    Apr 2001
    Location
    Gateway to the West
    Posts
    1,930

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    ~*~Drusilla~*~
    Ah, the night. I watched the battle below. I'd found many years ago it was useless to run into those things while there were weapons out. The large scar running down my left arm was proof. The girl, however, intrested me. She wasn't completely human, I could tell that from the start. But she developed wings. Her expression hid it, but she was not used to it. I was most definatly intregued.
    I lept down from the building to the alley. They all turned to me, weapons raised.
    "I am not here to harm you," I said softly. I was disguised as a vampire hunter. I had the skill that I could pass off for one. I was dressed in black leather pants, tall boots, a sleeveless black shirt, and a trenchcoat. The Ferals sniffed at me.
    "Vampire," growled the female.
    "Yes, dear, I am. I hope you don't take it personally. I rather like it, and I do try not to offend people with my state of being," I replied cooly. "Are you all right?" I asked her, noticing her slight injuries. It was more of a polite rhetorical question.
    "None of your business!" she snapped back.
    I laughed softly. "Oh dear, we are waspish aren't we? No matter. That was a freelance vampire, I have nothing to do with him. I'm not loyal to anyone; you buy my support. When your money runs out, I'm likely to kill you. It's the only way to survive anymore. Well, as there seems to be no permanent damage here, I'll leave. Of course, if you ever need me, just ask around. Ask for Drusilla," I turned on my heel, jumped up to a fire ladder that hung over the alley, and swung myself up to the roof with catlike grace. I was thankful that, yet again, the Feral hadn't taken the chance to kill a vampire. It would be rather bad for business for me to die completely.
    I ran accross the roof and jumped to the next. I hoped that I had made an impression. Doubtless, they had heard of me. It was nearly impossible to be in this city for more than a few days and not hear of me. Even the humans knew of me, though they did not know what I was. No matter...
    I made it back to my apartment an hour before dawn. I climbed in the window and pulled down the shutter. The night hadn't been wasted... I grabbed a carton of Ben and Jerry's from the freezer and plopped down on the couch to see if there was anything good on TV. Nothing... nothing... nothing... I gave up and put my Slipknot DVD in. I never got tired of it... Soon, I fell asleep, only to be awakened by a phone call many hours later...
    ~*~


    [Annie] - Kurosakura says: Dru Dru, your RP's not rated M XD
    Drusie says: Oh fuck.
    Headbutting a car = not fun! says: It is now.
    -------------------------------

    3DS Code: 5300-9721-4472
    Switch Code: 1866-7493-0014
    PoGo Code: 5716-4300-0144
    Steam: Jessyrah

  19. #19
    Banned
    Join Date
    Jan 2003
    Posts
    1,256

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Originally posted by Ultimate Charizard
    Ill let it go this time DarkTemplar but next time try not to rush the time on too fast.
    Incase you didnt notice theres a whole thing going on that will take time to resolve and any Vampire char's are gonna have a hard time posting when the sun is up.

    It can be worked around this time i guess just be a little more considerate.
    My bad, sorry about that. I'll wait till everybody catches up a bit to finish the post

  20. #20

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    *is, as usual, lost*
    Ah well...
    Please excuse the short post; I'm too feckin' tired to do much at all.


    Farson Marrinor
    ------------------------------

    So many, many people. They walked as I walked in a sense; one foot, then another foot. It was different too, though. I walked more swiftly, more like a shadow of the night than they could even comprehend. Some saw it, yet none knew what it was. So much the better.

    Straying away from the main crowds, I started toward the park in the center of the town. Taking a victim was much better when out of view of the majority of the public. There was something about the drawing of the blood that fairly screamed for solitude, for its own scene. Death was beautiful, a work of art.

    Often those who were to be taken fought against death, but this could not keep them from being taken. The urge was too strong in me, and no matter how demonic they found the process, they ended up loving it. To be taken in such a manner was to be a given a passionate death that could be matched by no other.

    It was receiving and taking all at once, sharing an experience more intimate than any other. Why would anyone shy from it?

    These thoughts running through my mind, I started into the park. It was one of the most beautiful city locations at night; perhaps one day I'd leave the city for the real outside, the forests. This, as I could see, would be the truest asset to my lack of fear for the sun...

    Soon. For now, the park would work well enough.

  21. #21
    A serious brain-f*** Advanced Trainer
    Advanced Trainer

    Join Date
    Sep 2002
    Location
    The "awesome" accents factory
    Posts
    2,408

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Appologises for very bad posting earlier. Promises not to make stupid mistakes again.

    Sam
    ~~~
    "Dammit, I had that demon..." I growled as I walked through the shadows.
    I couldn't believe I'd lost the fight, I hated the thought of losing to a demon, especially when my reward would have been a half-demon half-human hybrid.
    I kicked a can, it slammed against one of the walls. I looked up at the sky, I still ahd some time left before I usually made my retreat. Maybe the demon hunters have gone...
    I decided to go back. I wanted that girl, the one who was half human and half-demon, every vampire did, and I'd get a reward if I happened to be the one whol delivered her.
    I went back, sticking to the shadows on the rooftops. she was still there, surprising actually. Unfortunately so were the demon hunters.
    I dropped onto my stomach and watched in silence. The second she was alone, I'd get her.
    WANTED:

    One signature.
    Experience preferred although training will be provided.
    Witty slogans only, please.

    Imooto-deshi says:
    "BEEEE A ROUGE TOMATO"

  22. #22
    :3 Master Trainer
    Master Trainer
    Bulbasaur4's Avatar
    Join Date
    May 2000
    Location
    A Small Cardboard Box
    Posts
    6,105

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Dhaeraow (Perya Morwen) - F - Demon/Human
    ***


    I watched as the male demon went to the female one and asked her if she was okay... and then a vampire named Dru came suddenly out of no where. It caught me off guard- all of this happening at once... until the vampire left us alone once again with our thoughts.

    Well that was rather quick.. I thought, as my eyes squinted in the night air but no trace of her was left.
    Instantly the two demon hunters stood up, the male helping hte female and I quickly decided perhaps I should leave. Taking a step away my wings quickly retracted with a rather loud 'snap!' blood spattered in the air- left over from the now dead vampire, and sprayed the ground as a few more drips finally landed upon the concrete. This got the male demon's attention, as he looked at me.
    "Where are you going?"

    He asked, as I quickly stopped and gazed at the two. My icy, cat-like stare was rather full of bewilderment... as if it wasn't obvious. The question strangely caught me off guard however...
    " Away from you demons... "
    I continued to walk away, but strangely the female spoke.
    " So you're just gonna walk away from us? After we helped you with those vampires?"

    I stopped dead in my tracks, and felt the red hot flaming fingers of anger grab at me... sighing deeply, trying to control myself I turned around to face the two. My dark, violet hair hung in front o fmy eyes as they narrowed to give a cold stare- the one I've been using for a very long time with the likes of demons and vampires.
    " First of all, I didn't ask for your help and I could have taken the vampire by myself. Secondly... I don't know why you decided to fight- but if it was so you could take me down yourself, then I'd rather leave before the half kindred kills me like they've been wanting for so long."

    I stood there, gazing at them as if challenging them to speak anymore- but I didn't expect them to. Again, the male surprised me with an astonishing question.
    " Why would we want to kill you?"
    I turned my head away, almost to laugh at such an empty statement.
    " Aren't you just like the rest? I've been hunted all my life by the likes of my half kindreds and the vampires which hate both. I don't understand why tonight the one vampire wished to disable me then just simply kill me like the rest used too... but whatever reason it does not matter. Answer your own question. humans kill me because they despise demons and the thought of demon blood mixing with their own makes them want to destroy the mere thought of it. Vampires hate both demons and humans, so why not take two birds with one stone and kill me? As for demons... who knows- the thought of tainted blood by mortals? Betrayel that their species would dare put their own spawn into human flesh? I do not know but I know this: I do not trust my half kindreds. Just ashamed."

    With that I turned around, my metal wings glistening the the slight moonlight and began to walk away...


    (I'll let Gav decide if he wants my char to stay or not. ^^)
    [Please Send Tell]
    Video Games, Life, and the Random Objects You Trip Over

  23. #23
    Evil Plotter Advanced Trainer
    Advanced Trainer
    Mewtwo-D2's Avatar
    Join Date
    Nov 2000
    Posts
    2,350

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Sorry I'm late!
    Name: Siv Kismet
    Race: Human
    Age: roughly 28
    Looks: Long blond hair, ice green eyes, very Norse in general... Generally wears a light blue shirt, baggy khakis with plenty of pocket space. Has a veils-and-jewels, smoke-and-mirrors rig for when she's fortune-telling, but she doesn't wear it for common clothes. Also has a tatoo of an ice green, seven-pointed star over her left eye, and wears a necklace with the Fool card hanging from it.
    Abilities: Is pretty good at fortune telling ^^;
    Personality: Goodnaturedly greedy and self-serving. Her reason for getting involved is basically that no vampire needs the services of a human fortune-teller, even one that is semi-accurate. So, basically, she plays nice with others so she can get what's best for her.
    History: As a baby, she was abandoned on a doorstep and taken to an orphanage. There, a social worker with a literary mind named her Siv, after the golden-haired goddess of Norse legends.
    Around the age of 16, she met an old man who was telling fortunes; he told her to draw a card from his tarot deck, and she drew the Fool. He told her that kismet had drawn her to him to start her new journey in life. She told him she would be his apprentice if he could guarantee a high income. He told her a good fortune-teller could command any price she desired, and she left the orphanage to become his apprentice. He is still her main boss, but he's quite old now and in failing health.
    Allegiance: Herself.... ^^; Freelance
    Other: Carries her equipment in her pockets: tarot cards, tea leaves, crystal ball, etc. Always be prepared to sucker someone out of their money, as she says.


    Siv
    ~~~~~~~~~~~
    I looked up from my dinner as I heard screams and other such ruckuss from outside.
    "It's a busy night tonight," I commented, going to the window to light the lamp. "Maybe it'll attract some customers."
    Despite my superior skills, business had been lax for the last few weeks. Vampires were getting more bold, and few people wanted to hear their fortunes told during the day. It was so much more mysterious at night, but who was going to brave vampires to find out if the cute cafeteria worker really had been eyeing them?
    "Maybe I'll attract a vampire customer..." I smiled to myself. I had never tried to read one of them, so it might be interesting. That, and vampires were supposedly lavish spenders.


  24. #24
    The cult of personality..... Elite Trainer
    Elite Trainer
    Master Rudy's Avatar
    Join Date
    Jul 2000
    Location
    The 8th Circle of Hell (AKA Kentucky)
    Posts
    3,790

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    There's been a minor change in my profile. However it's nothing too big. Just something I failed to mention at first ^_~

    Name-David Summers
    Race-Human
    Age-23
    Looks-Stands at about 5'11". Has short blond hair, hazel eyes and wears glasses. Normally wears a grey t-shirt with blue jeans and a denim jacket.
    Personailty-Very easy to get along with and is friendly towards just about anyone. Despite this he might get a bit of a temper if he feels that someone is being mistreated. He's the type that doesn't believe in certain things and thinks most things can be explained easily. However if you show him hard facts chances are he won't argue with you.
    History-Works as a photographer for a local newpaper. He met Brandy about three years ago. Despite her telling him it was a bad idea he eventually convinced her to go out with him. About a year and a half ago the two of them got married. Has no clue about the existance of vampires and that some of his friends and even his own wife are not human. The only thing keeping him from learning about his wife's secret is a very convincing and well thought out cover story.
    Allegiance-Freelance
    Other-Has some knowledge and training in martial arts from when he was younger. Back in the day he was the top in his class. However he lost intrest and eventually quit. Because of this he's extremely rusty due to not training in several years. Chances are David couldn't hold his own against someone else who is stronger or has much more experience. Despite his weaknesses he is a quick learner and could become a decent fighter if he stopped slacking.


    David Summers
    ------
    To a normal couple this could have seemed odd. However to myself and Brandy it was just an everyday thing. She'd come home and then after about an hour or two together I'd be off to my own job. It was all due to her condition known as XP. It didn't take long for me to learn about it. However in the three years we've known each other I had found out that Brandy was a real trooper. Despite having a very rare disorder she made the best of things and was living a normal life like many other people. It was a bit sad that we couldn't do some of the things others did. However it made no difference to me. It wasn't like it actually changed who she was.

    While I was getting ready I saw Brandy looking at the shelf I had for my movies and books. "Well I see someone went shopping while I was gone" she had said as she looked through my new books and commented on them. With a chuckle she said "First off we've got Rainbow Six. I guess 20 Bond movies wasn't enough for you was it?" I shook my head and told her "You also can't forget Mission: Impossible." Moving on she came across something I had been wanting to get for a long time. "Not a bad pick. You got the Lord of the Rings trilogy. However being the lazy person I am I think I'd just wait for the third movie." I started to laugh over that when her suddenly serious look made me stop. "Something wrong?" I had asked her. All she did was hold up the third book for a moment before saying anything. "Since when do you read Anne Rice novels?" With a shrug all I did was say "I figured I'd try something different." Brandy looked over some of the book as I went to grab my camera. As I passed her I heard her whisper something to herself. Curious about it I asked "What was that about the book?" My wife just smiled at me and said "It's been a long time since I've read one of these." I must have been a bit tired myself because it sounded more like "This is all wrong. Who would read one of these?"

    I would have liked to stick around and take the time to read one of those books but it was time for me to get going. Glancing at the clock I saw it was about 90 minutes before Brandy would be confined to indoors. I had to be at the office within the hour but it was more than enough time for the two of us to get some breakfast together. It had been awhile since we had a chance to do something like this. Since I knew how strange our hours were when compared to each other I knew there was no telling when our next chance to do this would be. Looking back at Brandy I said "Your not feeling too tired are you honey?" However she seemed to get the idea of what I was going to ask. The two of us were already in our car with me behind the wheel before we could even decide on fast food or some small diner.

    ******
    15 minutes later
    ******
    After parking about a block away Brandy and myself were walking to one of the local diners. As we walked I talked to her about her research on XP. I wasn't exactly a scientist but I could tell she was having problems with it. She always seemed to get stuck in the same spot. I was about to encourage her to keep at it when the sign of a nearby shop caught her eye. "A fortune teller. You don't see many of those around town" she said. I wasn't sure about Brandy but I didn't exactly trust them. There was no way to prove right there on the spot that they were telling the truth. I was always someone who liked to look at the facts about something rather than trust fate. Working with reporters as a photographer didn't change that viewpoint. However she seemed intrested in this fortune teller and walked it. Normally I would have made a comment about people like these but I figured it would be intresting to see one in action......
    ------

    Not one of my best intros but I think it sets up the things to come for Brandy and David pretty well. It should be intresting to see what direction these characters go in.
    TPM's self proclaimed firearms expert, former RPG mod, occassional smartass and all around enigmatic wonder ^_~
    3DS Friend Code: 3196 4256 7846
    XBL: Enigma1985 NYJ
    Steam: enigmaticwonder
    FF.net: https://www.fanfiction.net/~enigmaticwonder85


    Stay your blade from the flesh of an innocent.
    Hide in plain sight.
    Never compromise the Brotherhood.
    Nothing is true, everything is permitted.
    -The Assassin's Creed

  25. #25

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Name: Taben Kaishin
    Race: Demon (Vapor demon) - Vapor demons have a very different cycle of life from most beings. They only live to be about 30 but they advance at a highly excelled rate. Their life cycle is somewhat complicated and very limited. As one Vapor dies, their body becomes pure myst and it seemingly dissipates into nothingness. What really happens though is it reforms with new life. Over about a month that new life learns how to constitute itself as solid matter. That is how new Vapor demons are born. While this makes them very hard to truly destroy it also limits their growth as their numbers can never grow by any conventional or easily attainable means. The benefit of this method though is that each new Vapor that is formed inherits many of the skills that were learned in life by their predecessor so they get an early start in life, although no actual memories are retained fropm the previous lifeform. They are also quick learners so they are able to pick up most things they need to know in their short lives by the age of 5. The speed and agility of a Vapor demon is on par with the Feran breed of demons but their physical strength is lacking compared to most demons( it is slightly above that of the average human). However, they do possess the ability to turn their body's into a myst-like form that allows them to pass through solid matter. They can also convert any organic material they are touching into myst as well. When they revert to a solid state or when they lose contact with an object, the organic material also reverts to a solid state. While in this myst state a Vapor demon is able to enter anothers body and possess it. Only one with a strong mind and a stronger will can resist such a possession. The stronger the mind, the less time a Vapor demon is able to maintain this control. Any attempt at this can leave the Vapor greatly weakened though so it is usually reserved for an emergency.
    Age: 24(in appearance and spirit), 7(actual age)
    Looks: there is a pic attached below. His eyes are pure silver in color, the steel-toe part of his boots is actually made from bone but it is polished to look like chrome.
    Abilities: (see Race)
    Personailty: clever, mischievous, mysterious, loyal
    History: Being only 7 actual years old his history is very limited. Most of it he keeps private but it is obvious that he has something of grave importance at the back of his mind. He is not from Pernicious but a similar city located in Austria across the sea. He has come to Pernicious seeking aide but he is reluctant to explain why to anyone. Not much is actually known about him here in Pernicious except that he seems to be an extremely skilled martial artist and he is trying to find the fabled ruler Ashram Marduk. He won't explain to anyone his reasons why.
    Allegiance: Freelance
    Other: He wields a sword known as the Kai-shi Scimitar. It is an ancient sword made out of wood from a long extinct tree. It is kept in a leather sheathe on his back. As it and its sheathe are made of organic material. It's sheathe is the same color as his coat, the blade is curved like an asian broad sword, the guard is dull grey, the handle is black and the blade is black with three fiery red stripes down each side. This blade has been passed down in his Vapor clan for longer than can be remembered.


    OOC: it is much too late for me to type up a post now. Expect to one sometime in the next two days.

    [attachment deleted by admin]

  26. #26
    Just Too White & Nerdy Advanced Trainer
    Advanced Trainer
    Kuro Espeon's Avatar
    Join Date
    Oct 2000
    Location
    Virginia
    Posts
    2,099

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    FYI: I'm going to have my character interact with Rudy and Asilynne's characters. She's just going to trail them for now, so I can give Mewtwo or Asilynne a chance to post first.


    Roku Veradim:
    ~~~~~~~~~
    Suddenly, all of my senses began to tingle, sending an alert throughout me. I smelt it.....I heard it.....I could feel it vibrating through the air like an unmistakable aura that I could never forget. Yes...There was a Vampire nearby!
    And what luck! It happened to be the same vampire that I had been trailing for days. I could tell because of the scent of her...a foul stench it was! All vampires had that lousy smell! I could tell they were coming from miles away. But for some reason, this one had managed to evade me up till now. Wether it was done conciously or by fault, it had begun to aggravate me. Unlike most vampires, this one seemed to move around during the day quite often, but I had a harder time tracking her during the daylight hours due to my human form. So she had managed to elude me during the time when my senses were not at their highest.
    But that would end tonight. I could sense her smell, and she was very close by, obiviously unaware of my presence. But I smelled something else that sparked my curiosity. Alongside of her own, I found a human's scent! A Human? And it was still alive? That on it's own was puzzling enough, but there sheer fact that a vampire and a human were traveling together was down-right abnormal.
    No matter...It was unlikely that this human would interfere. Not when I had a vampire in my sight.
    I then spread my enourmous red wings and, giving them a mighty beat, I took off into the air and flew up to the roof tops. There I proceeded to glide lightly over the busy streets and alleyways below, my form hidden my the black velvet sky above me, scanning the ground below. I was narrowing in on my target! As I came closer I decided to land and take a more stealthy approach. I landed softly and silently on the pavement and continued on foot, keeping well in the shadows. As I turned the corner out of the back alley and out on the main street, I saw the pair I had been looking for. Yes! She was there! The vampire! The girl with dark reddish-brown hair and light green eyes, and a male human companion with Has short blond hair. I had found my target.
    The two of thenm seemed to be rather friendly with each other. It was most likely that this human had no idea that he was chating with a vampire. The two of them were preparing to enter a small store whose front was decorated by strange and elaborate hangings and draperies.
    I recognized this building. It was the home of the fortuneteller Siv Kismet, whose extravagant skills in divination were well known amoung the creatures of the night. But why would a vampire be going in there?
    To avoid being seen I ducked back into the alley and watched from around the corner as they proceed to make their way inside. She was gone for now...but it didn't make much differance. They had to come back out sometime, and when they did, I would be waiting to welcome this vampiric ***** with open claws...


    **Winner of the "Most Mysterious Character" Award (2009)**
    Sanya Halvacor - Kingdom Heartless


    Kuro's quote fav:
    "Take whatever you want, just don't headbutt me." - Bear

  27. #27

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Farson Marrinor
    ----------------------------

    "Beautiful, beautiful human..." I mused, stalking silently across the damp grass. "Beautiful, beautiful."

    Most humans failed to realize the stark beauty of thier lvies, especially when compared with the so-called lives of those who walked around as vampires, as demons; the ones who were not alive as the humans were. Thier lives were brilliant, beacons in the night, passion in the cold. Yet most failed to recognize this on any scale. To them, they only lived toilsome lives, with death at the end. The true beauty of thier lives would forever elude them.

    Unless, of course, a person were to be taken by a vampire. In the moments before death, the human would see the beauty of his or her own life before it was taken. In those moments, the human would not be remorseful. The human would be enveloped in the same passion that the vampire would feel, and both would be for the time drawn togetehr in an expression unmatchable by any other.

    A human, a young woman, was seated on a bench nearby, her head hanging slightly. She was depressed; I could sense this easily enough. She was not yet an adult, and she hated her life already. She wished for death as many did, but with more intensity even than was common. However, she had not the entire will to die...

    She would find her end soon. Walking over to her, I stood in the shadows, watching the light flicker slightly. "Clara." I spoke her name clearly and she looked up, startled.

    "Who are you?" her depression had taken on a tinge of alarm.

    "I am here to speak with you," I smiled bitterly. "Please."

    Then she stood up and walked toward me, her eyes widening somewhat. "I..." She couldn't speak coherently, couldn't find words to express what it was that she wished to say. I needed no words from her, though. I could read it, could understand.

    In some part of her mind, she understood what this was. She was frightened, yet she was accepting of it. This was everything she had wanted, everything she had feared. Stepping toward me, she moved without hesitation, finally standing before me with wide yet strangely empty eyes. "Please," she said, echoing the word I had spoken eerily.

    Without another word I stepped toward her, wrapping my arms around her and lowering my head to her neck. As I opened my mouth and exposed my teeth, I felt her body fall against mine, felt her give herself entirely to me. Such a strange situation, yet it had happened before. She loved this, she knew now that she did want it.

    Sinking my teeth into her neck swiftly, I gave it to her.

    ------------

    ...

  28. #28
    ~HOPES AND DREAMS~ Elite Trainer
    Elite Trainer
    Asilynne's Avatar
    Join Date
    Sep 2002
    Location
    Between tomorrow and yesterday
    Posts
    3,915

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    ~~Brandy Summers~~
    :::Less than two hours til Sunrise:::

    Queen of the Damned.
    Interview with the Vampire.
    These titles had echoed in my head, haunting me, reminding me of what I was after a night of almost forgetting. It was like a smack in the face, a scolding voice that said creatures of the night didnt deserve to be happy.

    But I wasnt about to let some title of a book ruin my day.

    David had to be at work in an hour. With him working by day and me by night, it wasnt often we got to spend a lot of free time with each other. I was thinking how nice it would be for the two of us to go out for an early breakfast before the sun came up and I would have to retreat into the darkness of the house to wait for another night. As if reading my mind, David looked at me. "Your not feeling too tired, are you honey?"
    I smiled warmly and grabbed his hand. "Of course not! Lets go!"

    ~~~~~~~
    ~~~~~~~

    A few birds twittered in the early morning dark as we walked from our car towards the mist-blurred neon lights of the small diner we had decided on. The slight chill of night still clung to the air, but my husbands warm hand in mine kept me from shivering much. I had to keep from laughing as my sensitive hearing picked up the low growl of his stomach. Well, somebody certainly is hungry, I thought as I smiled slightly to myself. I probably would be hungry too if I were human, as it was I had already fed once last night. Still, I looked forward to a nice hot meal, though I didnt really need the food to survive. It felt good to pretend I was human sometimes....
    Suddenly something caught my eye. It was a Fortune Tellers booth. Back when I was about 7 or 8 my parents took me to a fair, where a fortune teller told me my future. "When your life begins, it will end, but continue in darkness." At the time that freaked my parents out, and from then on they shunned fortune tellers and taught me things like that were silly and had no meaning. The search for answers of all kinds eventually led me into science, and science had no room for matters of the occult. So I had no idea why I should be interested in this particular fortune teller now.
    Without realising it at first I found myself walking in, the warm darkness of the shop lightly scented with inscense of some kind. I heard David come in after me and ask quietly curious what we were doing in here.
    I honestly didnt know, something drew me in here, something I couldnt explain, and then I heard a voice.
    "Ah Wellcome. Brandy Summers is it?" I jumped, momentarily startled at how she knew my name. Then David spoke and I instantly felt silly for being surprised. “Thats not very remarkable, considering she still has her nametag on.” He said, crossing his arms in disbelief. I smiled wryly. David never went for the whole smoke-and-mirrors thing, to him, everything had a logical explanation.
    The fortune teller smiled. “Well David Im guessing your not a believer are you?”
    Davids face fell. “What...but...”

    I decided not to tell him his name was etched on the leather strap of his camera. ^-~

    After we sat down, the fortune teller, whose name was Siv, studied us quietly for a few minutes. Her stare looked like it was seeing through us, it was like we were telling her all about us just by being in her prescence. It made me quite uncomfortable. I shifted my weight slightly and glanced over at David. He was sitting, slightly slumped in his chair, his arms crossed and looking back at the fortune teller with a skeptical look on his face. I smiled slightly and was about to tease him playfully a bit but then Siv spoke. “So. Tell me. What brings you in here? Nothing happens by accident, for everything there is a reason. So why have you come to me? What do you seek?” She looked at me first, waiting for an answer.

    Why was I in here? I wasnt sure. Usually I find stuff like this to be interesting though I dont take much stock in it. So what did possess me to come in here? “I....dont know...” I said, sheepishly. She studied me closer. “You do. Though you might not know it you had a reason for coming in here. Nothing happens by accident.” She turned to reguard David. “And you, why have you co----”
    Before she could finish he uncrossed one of his arms and pointed exaggeratedly at me. I chuckled to myself and Siv laughed. “I see. And as you will find, you will follow her in more ways than that.”

    With that mysterious line she got out a deck of strange-looking cards. She laid ten of them in some sort of pattern and studied them carefully. She seemed startled at what she saw. She stared disbelieving at the cards for what seemed like forever, and then when she looked up what she said was haunting. “You have a secret, a dark one. This secret is shrouded in levels of deceit. Very soon the darkness will take over your life and envelop those you care about, the secret will take its vengance for never being brought into the light. You are ashamed of yourself,” she pointed at one of the cards, “Every day is a struggle, your consience pulls you one way while your being pulls you another. Because of the secrecy of your dark past, you will bring about the end you have worried about for so long.”

    What was she saying...? Did she know, did she KNOW what I WAS?! She did, I saw it in her eyes. Horror crossed my features. What end was she talking about? What could this mean?

    “Bullsh*t.”
    Davids voice started me out of my worried thoughts. He sat upright in his chair and put his hands on her desk. “This is all Bullsh*t. I was thinking this might be a little interesting but this crap about ‘bringing about an end’? No.” He stood up and put a protective hand on my shoulder. “Come on Brandy lets get out of he--”

    Siv looked at him with her haunting eyes and when he began to speak he went silent. “Disbeliever. The cards hold your future as well. Your world is about to be turned upside down. Things youve believed will fall apart as things you never thought possible come to your attention. Yes...you will believe soon. You will believe much that you never thought was possible.”
    Davids eyes grew wide and then narrowed. “F*cking crap..” he said as he stormed out. I started to walk out after him when Siv stopped me for one last, final word. “He thinks he can protect you from the truth, from anything. But he has no idea whats in store for you, and for himself.”
    I turned at the door. “What do you....”
    She stopped me with a gesture. “He is the one that needs protecting. But in the end nothing you do will be able to save him from death.”
    I felt like an icy hand closed around my heart. She went on. “But change is eternal. He will die, but he will live on....in darkness....”
    The memory of that day at the fortune tellers from my youth hit me hard. “N...No...” I said and ran from Sivs booth in a panic. I wasnt watching where I was going and bumped into David hard. “Brandy!” He saw how frightened I was and grew angry again. “That damn fortune tellers full of sh*t. All they care about is swindling people out of their money and playing with their heads. Dont pay any attention to what she said. Nothings going to happen.”
    I looked at him for a minute then nodded. “Your probably right.. I shouldnt let it bother me.”
    As we continued walking towards the diner, I still couldnt help but think about what Siv had said. How the last thing she said seemed to mirror what that fortune teller had said about me when I was younger. I did die, and I did live on in darkness...

    My life was a living hell because of that night after graduation. I couldnt imagine something like that ever happening again, the world wasnt so cruel that it would take all light from it....surely....
    I shook that thought from my head. Ill never let that happen to David....

    ~~~~~~~~~~~~~~~~~~~~~~~
    I know Davids a nice guy but I figured the fact that he thinks fortune tellers are full of crap anyway mixed with the fact that what shes saying is really worrying Brandy would get him a bit mad...sorry if hes OOC ^-^()
    This is chock full of forshadowing in case you couldnt tell ^-~ lol
    Im giving Kendo a chance to post the details of the tarot reading since shes the expert fortune teller ^-~




    .: Ben + Brandy :.
    .: September 14th 2012 :.



  29. #29
    Evil Plotter Advanced Trainer
    Advanced Trainer
    Mewtwo-D2's Avatar
    Join Date
    Nov 2000
    Posts
    2,350

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Siv
    ~~~~~~~~~
    I frowned as the couple hurried away. I did so hate to be the bearer of bad news. But there it was... her secret would destroy them.
    I sighed and shuffled the cards again. If they had stayed she could have tried to draw a second chance. But since they had left in such a big rush, I would have to do it mysef. Quickly I went over her reading in my head: Lovers, her strong relationship with a husband who wished to protect her. The Wheel of Fortune, inverted, the turn of fortunes that resulted in her condition. Justice, her sense of integrity that would end up destroying her. The Devil, the bonds of deciet she had chained herself and her husband in. Death, inverted, literal death, and the beginning of her life as a creature of the night. The Moon, ironically appropriate, on top of the knowledge of her future that she already had. The Hanged Man, inverted, her refusal to accept her nature. Judgement, a challenge to be faced... decisions to be made. And finally, the High Priestess, inverted, quiet, hidden power she would need tp find on her own.
    I finished shuffling the cards and pulled the one from the top: The Wheel of Fortune... her destiny was circling wildly. Hopefully, she would consult me again before she was thrown, helpless, before fate/


  30. #30
    The cult of personality..... Elite Trainer
    Elite Trainer
    Master Rudy's Avatar
    Join Date
    Jul 2000
    Location
    The 8th Circle of Hell (AKA Kentucky)
    Posts
    3,790

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    David Summers
    ------
    As we sat there in the diner I couldn't help but notice that Brandy had not touched her food at all. This wasn't like her. Setting down my fork I told her "Look if this is about my outburst a little while ago I'm sorry." Shaking her head she said "It's not that at all David." I frowned when I heard her say that. "That fortune teller?" were the only words to come out of my mouth. Brandy seemed to have something on her mind and just remained silent. With a sigh all I did was sit there and think about that encounter.

    Brandy suddenly spoke up. "David I know you really don't believe in those things but you've got to listen to me." Normally I would have found the way she was acting silly. However since when was my wife ever so concerned about something? She looked as if she had something very important on her mind. "I know you like to believe everything can be explained. However there are things in the world that can't be explained easily." Where was she headed with this? With a deep breath Brandy went on. "When I was a child me and my parents had seen a fortune teller. We figured it would just be something intresting that we could do for fun. What that teller said was downright chilling. She told me that when my life begins it would end but continue in darkness."

    For a moment I let all that sink in. Was that why Brandy was freaked out? She looked as if she was going to say something when I spoke up first. "It's strange that someone would get that right. It seems to be refering to XP. People say you life doesn't really start until after high school. If I'm not mistaken you started to develop the symptoms around that time. I guess she was trying to say it would be the end of a normal life." Brandy just sat there for a moment and finally agreed "Yeah I guess your right David. I'm surprised you actually believe me." As she said that I looked at the clock. It wouldn't be long now. Brandy had to get home before the sun came out. After paying for breakfast we left and started to make our way back to the car. While I didn't say anything to Brandy I couldn't help but think about her attitude in the diner. Something was not right at all. I felt as if she was hiding something.

    Little did I know just how right I was......
    TPM's self proclaimed firearms expert, former RPG mod, occassional smartass and all around enigmatic wonder ^_~
    3DS Friend Code: 3196 4256 7846
    XBL: Enigma1985 NYJ
    Steam: enigmaticwonder
    FF.net: https://www.fanfiction.net/~enigmaticwonder85


    Stay your blade from the flesh of an innocent.
    Hide in plain sight.
    Never compromise the Brotherhood.
    Nothing is true, everything is permitted.
    -The Assassin's Creed

  31. #31
    Just Too White & Nerdy Advanced Trainer
    Advanced Trainer
    Kuro Espeon's Avatar
    Join Date
    Oct 2000
    Location
    Virginia
    Posts
    2,099

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)


    Roku Veradim:
    ~~~~~~~~~
    I watched from the shadows as the two went towards their car. I had followed them when they had left the Fortune Teller's place in order to study my target more closely. But I had to make my move, and I had to do it soon. For soon, the sun would be up and I would lose my chance, yet again, to fight her.
    Over hearing parts of their conversations, I had heard her refer to the human as "David". I normal human name if I ever saw one. And he had called her Brandy. Brandy, huh? Not a very vampiric name...but it didn't make much of a differance...
    Since I wasn't one for the cowardice of surprise attacks or ambushes (I liked for my opponents to have a fair chance), I decided to show myself. I slowly stepped out of the shadows and drew up behind them. I made a mental note to myself to make sure not to harm the human. This had nothing to do with him. Then...in a low, challenging voice I called out.
    "Creature of the Night! Evil being of the shadowed city! I have come to avenge the lives of all the innocents that have been claimed by your kind! Turn and face me, vampire! Fight me or die!"
    The two spun around, looks of shock and horror on their faces. I flexed my wings and smiled, purpousefully baring my sharp, dragon fangs, my blood red eyes shining under the remaining moonlight.
    "Your reign of evil ends tonight! I, Roku Veradim of the Kage-Ryu Dragon Clan, will be your end!"


    Please remember, Roku doesn't know that Brandy isn't an evil vamp. To her ALL vampires are evil incarnet and should die. Don't take it personally! ^_^


    **Winner of the "Most Mysterious Character" Award (2009)**
    Sanya Halvacor - Kingdom Heartless


    Kuro's quote fav:
    "Take whatever you want, just don't headbutt me." - Bear

  32. #32
    ~HOPES AND DREAMS~ Elite Trainer
    Elite Trainer
    Asilynne's Avatar
    Join Date
    Sep 2002
    Location
    Between tomorrow and yesterday
    Posts
    3,915

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    ~~Brandy Summers~~

    I was going to tell him. I started off by telling him about what the fortune teller had said when I was younger. I told him it came true. And then I started to tell him....the truth. What that prediction meant for me, and what it meant for him. That he was married to a vampire, a creature of the undead. I was going to tell him....
    But as it turned out, he spoke before me. Assuming it was XP the teller was refering to, David went on to say it probably meant the end of a normal life. He had no idea....

    After that I had lost my nerve. I wanted to tell him, I shouldve told him. But I didnt.

    And now someone was telling him for me.

    "Turn and face me vampire!! Fight me or die!!!" I froze as I heard that, David whirling around. I heard his heart begin to pound faster, the blood rushing through his veins at an incredible speed. "W...What..." It had to be something bad, David was not the type to startle easily. When I turned around, I saw that I was wrong.
    This was VERY bad.
    It was a demon, and by the looks of it it was a dragon of some sort. The huge leathery wings, the blood red eyes, and the sharp fangs made it a fearsome sight. But what scared me was what it had said. It knew I was a vampire! As David recovered from the initial shock he grabbed me and started backing up. "Im going to distract it....you get in the car, and if I dont make it back right away then start driving and get the police." He said in a hushed, intense sounding voice. But the demon wasnt going to let that happen. It strode up and grabbed David by the neck. "Stay out of this, Human, I have no problem with you." It tossed him aside like he was made out of feathers and he landed on the ground hard. The demon began to walk towards me. "Yes, your an elusive one, Ive been tracking you for days...but somehow you always managed to get away. Well, this time your mi----" The demon was cut short as David tackled it from behind. Getting it in an armlock he yelled, "Brandy!! Get out of here!!! I got him!!!" The demon twisted around and grabbed David again. "Him?!" It asked, sounding offended. "I am Roku Veradim of the Dragon clan for your information and I HAPPEN to be a girl." 'She' narrowed her eyes and brought David closer to her face. The fear in me was starting to give way to anger. "Why are you protecting this vampire? Is it because it has a spell on you? Or is it that your hoping it will TURN you! THATS why youve been travelling with it! Your no better than that undead scum!" The demon Roku brought up her clawed hand and was going to slash David. David would be killed. But the demon didnt count on my anger.
    Faster than I could think I had the demon by the throat and lifted her off the ground. Surprised at my sudden course of action, she dropped David and he scooted back out of the range of both of us, his eyes wide with horror. "You leave my husband alone...." I said in a low angry voice, as I squeezed her neck and lifted her higher. The demon grinned. "So youve decided to show your true self, rather than hide in that lame human form..." She sneered, and once again I froze. My fingers relaxed on her neck and she pulled away, preparing to fight me once again. I looked at David, with a shocked expression on my face but it was nothing compared to the look on his. He looked like he was trying to talk, like he wanted to run, but he did neither. Just looked at me, like I was a monstor.
    Which I was...
    ~~~~~~~~~~~~~~~

    Im going to cut it short right here....heres how it stands, David knows shes a vamp, and her and Roku still have issues to work out, so Rudy and Sarah take it away!! ^-^




    .: Ben + Brandy :.
    .: September 14th 2012 :.



  33. #33

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Sorry its been so long

    Keruga'Vyorn (Gav)
    -----------------------

    The female demon turned and walked away. She wanted to leave that was for sure but why would she want to be alone? Something was going on. Attacked by two vampires and neither wanted her dead?

    Sakea stood and was about to go after her but i put an arm on her shoulder. "Let her go, we'll tail her for a while, just incase there are more vamps after her but its gonna be light soon, the vamps will be goin to hide and i know a great cafe that does English Breakfasts, sausage, Bacon, Fried bread, the works!"
    I grinned as she sighed "You always did think with your stomach"

    "Yeah well then i have to get to work, i always go in early see if anything has shown up during the night...and i dont want to see you in the mens room again"
    She laughed and then fell silent as we jumped back to the low rooves around us, quietly following the injured female.
    As we continued i heard a scuffle, and someone shouting. Sakea snapped her head round, sniffing the air. "Dont get distracted, you follow our friend here, ill check it out. Ill meet you back at my apartment in an hour ok" She nodded and continued ahead as i moved off towards the sound.
    I jumped to the floor and stood just within the shadows of an alley. A Draconis demon was out in the street, challenging a vampire. A human male stood close by. The vampires prey obviously. The vampire seemed reluctant, and outclassed with no real fighting stance.

    A freshly turned vamp, the best time to pick them off, stop them doing too much damage. As i watched the human jumped up and stood before the Demon, seemingly shielding her. The Demon reached up and batted him away with ease and the Vampire screamed the humans name, her voice thick with concern. "Could it be, is she one of the 'Reluctants' a Vampire who only wishes to continue her human life" I had heard of a number that lived like this. Innocent enough with no desire to harm anyone, all they wished was to be left alone and for me that was not a problem, as long as they threaten noone i dont threaten them, i will not kill that which will not fight back.

    This demon has no such morals however as i watch it stalk towards the vampire. My instincts say i should move to help but i decide to wait, to test this vampire. Is she as reluctant as she seems....

    Afterworld ~ Chapter 2 | Blood Bowl ~ Chapter 3
    If nothing else works, a total pig-headed unwillingness to look facts in the face will see us through.

    ASB Record
    W-12 ~ D-2 ~ L-2

  34. #34
    Just Too White & Nerdy Advanced Trainer
    Advanced Trainer
    Kuro Espeon's Avatar
    Join Date
    Oct 2000
    Location
    Virginia
    Posts
    2,099

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    I'll give this a try....I'm not too good at battle scenes...


    Roku Veradim:
    ~~~~~~~~~~
    "So youve decided to show your true self, rather than hide in that lame human form..." I sneered as she relaxed her grip on my neck. I landed on the ground and regarded her with an amused smirk. "You have quite a grip. But I'm afraid a good grip won't be enough to defeat me." I said, holding up one of my clawed hands in a threatening pose.
    I glanced over at the human who was staring at the both of us with a look of shock and sheer terror on his pale face. I was obvious to me what was going on now. It seemed that that human was this vampires husband, and he was unaware of the fact that his wife was of the undead. She had probably never told him in order to protect herself. Though I didn't blame her...vampires weren't, how should I say?, very well liked...especially by they're prey. I felt sorry for the human. He could fallen victim to her appetite and any moment she chose.
    But maybe - the thought occured to me - that maybe she hadn't revealed herself for another reason. What if...she actually had feelings for this human husband of hers and was actually able to control her herself around him to prevent from harming him. That might be possible...but just because she spared one life, didn't mean that she hadn't taken others.
    Yes...I felt sorry for the human. For even though this Brandy was his wife, she was still a vampire, and therefore my enemy. And she must die...
    But the vampire didn't seem as eager about this battle as I. The boldness she had just displayed was gone again, disappearing just as quickly as it had come. But nevertheless, I would make sure that she defended herself.
    "Well, vampire? Shall we get this moving? The sun will be rising soon and I'd prefer for this not to take too long...and we ALL know how much you vampires hate the sun. Am I right?" I chuckled and grinned at her.
    "Why..." I heard her say quietly, then slightly louder, "Why?! Why do you want to kill me? I never hurt anyone! And I never did anything to you!"
    "Oh trust me, it' nothing personal, vampire. I simply hate you and your kind. And don't think you can fool me with that "I never hurt anyone" completely innocent act! I know perfectly well you are not innocent! All of you vampires need blood to survive, and you can't have lived without some source of blood! And that source is very abundant in a city full of humans, wouldn't you say?" On this last sentence I gave the human, David, a sideways glance, a small draconic grin on my face.
    "Shut up..." Brandy growled.
    I looked back her, the grin fading off of my face and being replaced with a serious scowl.
    "Every one of your kind deserves to die. I dedicated my life to erradicating the race of vampires, the creatures that are responsible for my fathers disappearance! I will have my revenge!!"
    With that last word I leapt up and, using my wings, propelled my self forward with tremendous force. I swung my clawed hand in a diagonal slash across her chest, which she managed to dodge. Regaining my footing, I attacked again.
    "Come on, vampire! Defend yourself!"


    **Winner of the "Most Mysterious Character" Award (2009)**
    Sanya Halvacor - Kingdom Heartless


    Kuro's quote fav:
    "Take whatever you want, just don't headbutt me." - Bear

  35. #35
    The cult of personality..... Elite Trainer
    Elite Trainer
    Master Rudy's Avatar
    Join Date
    Jul 2000
    Location
    The 8th Circle of Hell (AKA Kentucky)
    Posts
    3,790

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    David Summers
    ------

    This couldn't be happening. It was like a dream.....no. More like a nightmare. However I couldn't wake up. This was real. There she was with silver eyes, pale skin and fangs. At any other time I would have laughed over something as silly as this. But this was not a laughing matter. Despite what a sensible person would believe I knew I could not ignore what I was seeing. Vampires were real and Brandy was one of them. It didn't take long for me to accept the facts. The problem was wondering if Brandy really did love me. Did she actually see me as a quick meal for the future? As shocking as this was to me I still had the sense of mind to know I should smack myself for thinking that. Of course not! If she did then I was sure she would have bitten me the first night we met. With a sigh I said outloud to myself "So this is why you warned me and said our dating might not be a good idea on that night three years ago?" While I wasn't directing that question at anyone I just sat there as both Brandy and the monster called Roku looked at me. Ignoring her and focusing on only me she said "I was afraid that if I told you and if you saw what I really was then you would be afraid of me. I didn't want to scare you away." I still wasn't sure what to think of all this in such a short time. However I knew for a fact that Brandy was a good person. Getting up I told her "You should have just said something. Your my wife after all."

    Brandy was about to say something else when suddenly Roku challenged her to a fight. It was clear that Brandy wanted no part of this. Roku on the other hand looked like she was out for blood. Seeing her go after my wife was the last straw for me. Right now I just didn't care about anything else. The only thing on my mind was protecting Brandy. I hadn't trained in a few years but I took up a stance and got between the two of them. This seemed to surprise Roku but it quickly gave way to anger. "So you'd throw your life away for her. What makes you think she won't thank you by draining your blood until you also become one of those evil demons?" As I took a small step forward I said "Well you don't know her like I do. I've known her for three years and have lived with her for almost two. Trust me when I say Brandy is not a killer. I think I'll go ahead and take my chances with my wife." Roku would not hear any of it however. "You truely are a fool. How do you think she gets her blood every night?" I didn't answer her because deep down I knew she couldn't hurt anyone. I would stand my ground and not back down. Roku just stood there for a moment and watched before saying "I will admit you've got a serious amount of courage. I didn't want to hurt you but if your going to protect her then I'm afraid I have no choice."

    Roku took on her own stance at that point while Brandy just stood back and watched. I could easily see the look of horror and regret on her face. I knew she regreted not saying anything but I couldn't blame her. It's not exactly something that is easy to say. She also looked liked she was very afraid of what might happen to me. I was also very afraid because I had no clue about how the hell I was going to protect her from something like this......
    TPM's self proclaimed firearms expert, former RPG mod, occassional smartass and all around enigmatic wonder ^_~
    3DS Friend Code: 3196 4256 7846
    XBL: Enigma1985 NYJ
    Steam: enigmaticwonder
    FF.net: https://www.fanfiction.net/~enigmaticwonder85


    Stay your blade from the flesh of an innocent.
    Hide in plain sight.
    Never compromise the Brotherhood.
    Nothing is true, everything is permitted.
    -The Assassin's Creed

  36. #36
    Advanced Trainer
    Advanced Trainer
    Drusilla's Avatar
    Join Date
    Apr 2001
    Location
    Gateway to the West
    Posts
    1,930

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    Hmm... well, as has been pointed out, things are going to be intresting with the vampire characters not moving during the day.
    Oh, and Ginger, when you get to it, can you clear your PM box so I can PM you?


    [Annie] - Kurosakura says: Dru Dru, your RP's not rated M XD
    Drusie says: Oh fuck.
    Headbutting a car = not fun! says: It is now.
    -------------------------------

    3DS Code: 5300-9721-4472
    Switch Code: 1866-7493-0014
    PoGo Code: 5716-4300-0144
    Steam: Jessyrah

  37. #37
    Banned
    Join Date
    Oct 2002
    Posts
    117

    Default wow im late

    Name: Vaname S. Wilsh

    Race: Demon

    Age:about 600.

    Looks:Red hair about the size of vash's, only he has bangs over his left eye. Eyes that look as though flames are reflecting off of them. Wears a black trench with cut off sleaves & red trime. Boots that come almost to his knees. and leather shirt and pants.

    Abilities: Demon: can shape-shift, and turn into a wolf type demon
    mainly the ears and claws (like werewolf)

    Personailty:Layed back. enjoys going after priests. unknown most of the time..unpredictable.

    History:Born in britian. during the dark ages, Vaname had many battles after being taught by the best class demons. When he was about 60 years old, another demon in his old clan killed his sister and mother because he was top demon in his time.

    Allegianceampire ruler. He has not respect for other demons. so he may hunt them down for a little reward money.

    Other:hangs out at pubs.
    ~~~~~~~@~~~~~~~~~~~~~~

    The pub was dark and smelled of moist cigars, the dim ceiling was covered with smoke. I gulped my wisky down and slamed the shot glass down with a loud clash. The bar keep took a slow glance over and i grinned. I sat up and threw him what little money i had and started towards the door. Opening the door i saw what looked like some sort of street fight. Shrugging i put my hands in my pockets and looked at my feet as i walked. Without looking i bumped into a lady, "oops! Sorry miss." i said shifting my glasses so no one would see my eyes. Walking faster i bumped into another man spinning as i hit. Stumbling i walked faster, feeling blood go to my face. *Man im an idiot!*
    ~~~~~~~~~~
    i guess i need to meet up with someone ^,^,

  38. #38
    ~HOPES AND DREAMS~ Elite Trainer
    Elite Trainer
    Asilynne's Avatar
    Join Date
    Sep 2002
    Location
    Between tomorrow and yesterday
    Posts
    3,915

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    ~~Brandy Summers~~
    Just 8 short feet from the car....

    I didnt understand.
    But that was nothing new because I didnt understand a lot of things about this situation. I didnt understand why this demon Roku wouldve chosen me, out of countless vampires in this city, to want to destroy. Me, perhaps the only one in existance that DOESNT enjoy the immortality, that DOESNT revel in the feasting of blood. Me, who would be more than willing to trade eternal life as a vampire for a few short decades of mortal human life.
    I didnt understand her anger, her past, her motives for wanting just ANY vampire dead. But the thing I understood least wasnt Roku at all.
    It was David. He was risking HIS life, HIS mortal human life to protect me, even after knowing what I actually was! Deep down inside I knew he wanted to keep me safe, despite the fact that I was more likely to survive a battle as a vampire, because he loved me. But I had thought for sure that his love for me would have quickly cooled once he saw the monstor he was married to. Once he knew what I actually was, I figured he wouldve chalked the past three years up as a mistake and move on, maybe find a human wife, someone he didnt need to be afraid of. Because seriously, who can love a monstor who feeds on blood?
    To my surprise David acted as if he never thought of any of this. As him and the creature known as Roku exchanged words, never once was the word ‘monstor’ mentioned by him. Instead he addressed me as ‘his wife’, as if he neglected to notice the fact that I was deathly pale, my eyes glinted with a strange silver shine, and the fangs that were meant to be used for biting humans were easily seen as I gaped at the scene. Maybe.... It started to dawn on me. Maybe he’s seeing past what I am. Maybe hes in love with not WHAT I am, but WHO.... I looked at David, instantly regretting not telling him the truth, and also my earlier doubting thoughts. When this is all over...Im going to apologise to you David, and Im going to tell you everything.

    But I wasnt going to have time for reflection. Roku obviously wasnt going to go anywhere until I was dead, and if David got in the way she wouldnt think twice to kill him too. Looking at David, I knew he wasnt going to back down. He was determined to protect me, even if it meant dying to do so. And that was something I would NOT accept.
    Putting a hand on Davids shoulder I stepped forward closer to the demon. She crouched lower, expecting me to make a move to attack. Instead I put my hands up, and, going back into my weaker human form, I addressed the demon in a calm but stern voice. “I dont know why your so hell bent on killing vampires, but if you need one for your sacrifice of revenge, then here. All youll be doing is ending the life of someone who never asked to be a vampire in the first place, but if you think you can live with that then do what you have to. Just let my husband live.” I turned my head to look at David, a heartwrenching look on his face. I tried to manage a smile as I whispered, “Im sorry.” I didnt want to die, but more than that I didnt want to see anything happen to him. Especially since this trouble began because of me, because of what I was. And it wasnt fair for him to die for something he never really got a choice about. He never chose to marry a vampire.
    But right now David was choosing something else. Before I could say another word, he spoke up. “There will be no need for that Brandy. I may not know much about what the hell is going on here but I have figured out one thing...”
    I stopped. What was he saying? Roku seemed to have an idea of what he might be getting at and nodded. “So you've finally come to your senses. I will say that I'm sorry about all of this but it must be done.” A thrill of fear went though me as I heard this. What was she....
    But before I could think anything of it David broke in again. “No it won't.” He said sternly. “As I've said I don't know much about what's happening but I've figured something out......” David seemed to know what he was doing so I just watched him as he spoke fearlessly to the creature. “You seem to have a very high amount of honor and fairness. Chances are this could have been ended quickly with a sneak attack. Instead you've chosen to show yourself.” Roku seemed irritated that something was distracting her from the matter at hand and seemed anxious to continue the fight to the death. She crossed her arms and said somewhat bored, “Whats your point?”
    David put an arm around my shoulders and turned around, starting to lead me away from the demon. Without turning his head he said to her, “It wouldn't be very fair to attack someone while their back was turned would it?”
    I wondered at how brave David was when faced with things he didnt understand, and I hoped that bravery would be enough to convince Roku I wasnt one of the bloodthristy vamps like so many others.
    In the end whether we got away or not depended on her desicions......
    ~~~~~~~~~~~~~~~~

    Ok Sarah go for whatever you have planned! Oh yeah and thanks to Rudy for helping out on the last paragraph ^-^




    .: Ben + Brandy :.
    .: September 14th 2012 :.



  39. #39
    Just Too White & Nerdy Advanced Trainer
    Advanced Trainer
    Kuro Espeon's Avatar
    Join Date
    Oct 2000
    Location
    Virginia
    Posts
    2,099

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)



    Roku Veradim:
    ~~~~~~~~~
    The human turned his back to me, leading his wife away.
    "It wouldn't be very fair to attack someone while their back was turned would it?” He said with a small smirk as they walked towards their car.
    I was briefly dumbstruck, and I just stood there staring at him in disbelief. Then, a smile creeped onto my face and I burst out laughing. David and brandy stopped and looked back over their shoulders, obviously surprised to see me laughing. I broke my laughter breifly to speak.
    "Ha! Clever, human! Very clever indeed! I like you, kid! You crack me up!" I started laughing again, throwing back my head. "Maybe I won't kill you after all!"
    I stopped laughed and grinned at them. "But that doesn't change the fact that your little vamp wife still owes me a fight. Don't think yo can just turn your back to me and it'll be all over. I'm sorry but it doesn't work like that!" I paused, and crossed my arms over my chest. "However, I admire the amount of courage you both have and your willingness to sacrafice yourelves for each other. I see you really do love each other, and I respect that. But..that doesn't mean I can just ignore my duty, the duty I have to myself and too my family and my clan. Don't think I'll just walk away and forget this." I looked up at the horizon and saw the first pale lights of dawn in the clouds. I folded in my wings morphed slightly so that they were hidden again. "But seeing as it's almost sunrise, I don't think it's safe for either of us," I said loking at the vampire, "To be out and about, especially in our current forms. If I where you, I'd get shelter quickly vampire. That is...unless you want a really wicked sunburn!" I chuckled at my own joke and turned away from them, slowly changing back to my human form. "We'll finish this another night Brandy Summers. I assure you of that. So until we next meet...watch your back."

    As I started walking away, I began to wonder about the true nature of this vampire. If she really wanted me to leave her alone...she would have to show me some proof that her heart was completely pure and free from vampiric evils. And to do that would be difficult. IN my mind still, all vampires, wether they chose that life or not, stillhad that evil desire buried within their hearts. And if they did not watch it closely, it would one day swell up and consume them.

    She might be able to protect herself and her husband from me...but could she protect them from herself?


    **Winner of the "Most Mysterious Character" Award (2009)**
    Sanya Halvacor - Kingdom Heartless


    Kuro's quote fav:
    "Take whatever you want, just don't headbutt me." - Bear

  40. #40
    The cult of personality..... Elite Trainer
    Elite Trainer
    Master Rudy's Avatar
    Join Date
    Jul 2000
    Location
    The 8th Circle of Hell (AKA Kentucky)
    Posts
    3,790

    Default Sins of the Blood (Mature) 'An Ultimate Outlaw Production' (Starts)

    David Summers
    ------
    I wasn't expecting it to be this easy to get away. For a moment I had a feeling Roku would have attacked anyway. However my actions only seemed to amuse her. She may have been letting us go for now but somehow I had the feeling that we had not seen the last of her. For a moment me and Brandy watched from the car as Roku walked away and turned back into her human form. Once I was sure she wasn't going to try anything sneaky I started to speed down the street as quickly as I could. The sun would be up any minute now and I refused to have my wife get turned into a smoking pile of ash.

    Now that the threat from Roku was over with it gave me time to think about all of this. I assumed Brandy also had much on her mind. Seeing how worried she was about me finding out I guessed she was now concerned over what I might say. Finally after about a minute of not talking I just laughed a little and said "I'm guessing that whole thing about vampires sleeping in coffins is just a myth?" Brandy just seemed a little surprised over how I was taking all of this and said to me "I have no idea how you can be so calm over this whole thing. I just don't understand it at all. Here I was thinking you'd be afraid of what I was. Instead your just acting as if you didn't care about the fact that I wasn't human." Keeping my eyes on the road I told her in a more serious tone "It's not an act Brandy. I'll admit I was very shocked when I first saw you back there. However it's the truth when I say it doesn't bother me. I've known you for three years Brandy. I know that you couldn't hurt anyone. What you are doesn't matter one bit to me. The important thing is who you are."

    As we pulled up to our building I could see she was speechless. Looking at her as I got out I said "We can talk about this more once we're inside the building. I think the last thing we want is for you to get cooked by the sunlight." I knew there was no way Brandy would argue with the last comment about the sun. In only a few minutes we were upstairs and in front of the door to our home. However as I opened it Brandy yelled and jumped away as fast as she could. It didn't take long for me to find the source of her pain. Across from the door sunlight was coming in from an open window. Rushing inside I quickly pulled the curtain across it and cursed at myself for leaving it open like that. Something like that could have easily killed Brandy. As I went back into the hallway to let her know it was safe I saw her quickly turn away. "Please don't look at me David. Not like this!" she shouted as she held her left arm. I didn't see her face but her words and now pale skin told me what had happened. After being hit by the sunlight she must have lost her human form. As I helped her inside she just faced away from me the whole time. All I did was watch as Brandy sat on our bed and continued to face away.

    I was quickly getting the idea of how much she must have disliked what she was when I sat down next to her. Before I could say a word or do anything she moved away from me. With a sigh I said "I've already said I don't care about what you are Brandy. Do you think you could please let me see your arm?" At first she didn't do anything but then reluctantly she came closer to me. From the looks of things her injury was not serious at all. At the most it was nothing more than your typical sunburn. Typical for humans I reminded myself. Despite the fact that I didn't know much about real vampires I had a feeling that another second or two would have been much worse for Brandy. She was lucky that she moved away when she did. Except for some soreness I knew she'd be ok. As I looked away from Brandy's arm to her face she started to turn away again. However this time I would not let her face away. Reaching out for her face I soon got Brandy to turn and face me. I noticed something as I looked into her now silver eyes. In her mind she must have figured they were the eyes of an evil demon. However to me they were the eyes of a beautiful woman. I couldn't resist anymore.

    To the surprise of Brandy I leaned forward and kissed her.

    Brandy didn't try to stop me or pull away. However I could easily tell she was shocked and not expecting me to do that at all. When I moved away she seemed stunned and spechless. After a moment however she threw her arms around me and hugged me as she spoke in a voice that seemed slightly choked up. "Thank you" she said as we hugged each other. If she didn't think I loved her because she was a vampire then I had just proven otherwise......
    TPM's self proclaimed firearms expert, former RPG mod, occassional smartass and all around enigmatic wonder ^_~
    3DS Friend Code: 3196 4256 7846
    XBL: Enigma1985 NYJ
    Steam: enigmaticwonder
    FF.net: https://www.fanfiction.net/~enigmaticwonder85


    Stay your blade from the flesh of an innocent.
    Hide in plain sight.
    Never compromise the Brotherhood.
    Nothing is true, everything is permitted.
    -The Assassin's Creed

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •